View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_low_10 (Length: 319)
Name: NF10701_low_10
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 34859820 - 34859519
Alignment:
| Q |
1 |
ttgaaacaagcataacacaacacaactaagagaccaaaacatactacatttatgaattaactaaccatgaacccaaatctacgatttccaagattttctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859820 |
ttgaaacaagcataacacaacacaactaagagactaaaacatactacatttatgaattaactaaccatgaacccaaatctacgatttccaagattttctg |
34859721 |
T |
 |
| Q |
101 |
cactagttggaaggagtgaaccctggctaactttgagagaattcatgatttctgtagatgaatttagaactggagctgagaagtacagatacacctttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859720 |
cactagttggaaggagtgaaccctggctaactttgagagaattcatgatttctgtagatgaatttagaactggagctgagaagtacagatacacctttag |
34859621 |
T |
 |
| Q |
201 |
cttgttatgatcattagttgcctgtactgttctagtttcactgttaatttgaagtagcttttcgggtacatgagtcctgatgttgacatacacctttctt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34859620 |
cttgttatgatcattagttgcctgtactgttctagtttcactgttaatttgaactagcttttcgggtacatgagtcctgatgttgacatacacctttctt |
34859521 |
T |
 |
| Q |
301 |
ct |
302 |
Q |
| |
|
|| |
|
|
| T |
34859520 |
ct |
34859519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University