View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_low_17 (Length: 230)
Name: NF10701_low_17
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 45795209 - 45795430
Alignment:
| Q |
7 |
gatctttgtttatcaaatggtcagcatatattgaaatgaaataaaaaatgtgacactaattaaaggcatattgtttagtgttgaggagatt-aagttaat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45795209 |
gatctttgtttatcaaatggtcagcatatattgaaatgaaataaaaaatgtgacactaattaaaggcatattgtttagtgttgaggagatttaagttaat |
45795308 |
T |
|
| Q |
106 |
taccaaaagtagctgaccgaaagggggttgtaaccttggggtctattgatttgattccagtgacaatggttttcatagggccatcaccatacatgagaac |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45795309 |
taccaaaagtagctgaccgaaagggggttgtaaccttggggtctattgatttgattccagtgacaatggttttcatagggccatcaccatacatgagaac |
45795408 |
T |
|
| Q |
206 |
ttggtctaaattcttaggtacc |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45795409 |
ttggtctaaattcttaggtacc |
45795430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University