View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_low_19 (Length: 215)
Name: NF10701_low_19
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 21453115 - 21453214
Alignment:
| Q |
18 |
atatggttcgctgattttcctatatttaggctataaatagcctagcgttgtcttagttcaaagacatgttaccatatcgaaactcttgttttatcaataa |
117 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21453115 |
atatggttcgtggattttcctatgtttaggctataaatagcctagcgttatcttagttcaaagacatgttaccatatcgaaattcttgttttatcaataa |
21453214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 21453243 - 21453289
Alignment:
| Q |
151 |
cattaggtagctcatccttgtgatgagtgagtagtctcctttagtct |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21453243 |
cattgggtagctcatccttgtgatgagtgagtagtctccttttgtct |
21453289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 28216236 - 28216202
Alignment:
| Q |
151 |
cattaggtagctcatccttgtgatgagtgagtagt |
185 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28216236 |
cattaggtagctcatccttatgatgagtgagtagt |
28216202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University