View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10701_low_19 (Length: 215)

Name: NF10701_low_19
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10701_low_19
NF10701_low_19
[»] chr4 (2 HSPs)
chr4 (18-117)||(21453115-21453214)
chr4 (151-197)||(21453243-21453289)
[»] chr2 (1 HSPs)
chr2 (151-185)||(28216202-28216236)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 21453115 - 21453214
Alignment:
18 atatggttcgctgattttcctatatttaggctataaatagcctagcgttgtcttagttcaaagacatgttaccatatcgaaactcttgttttatcaataa 117  Q
    ||||||||||  ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||    
21453115 atatggttcgtggattttcctatgtttaggctataaatagcctagcgttatcttagttcaaagacatgttaccatatcgaaattcttgttttatcaataa 21453214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 151 - 197
Target Start/End: Original strand, 21453243 - 21453289
Alignment:
151 cattaggtagctcatccttgtgatgagtgagtagtctcctttagtct 197  Q
    |||| ||||||||||||||||||||||||||||||||||||| ||||    
21453243 cattgggtagctcatccttgtgatgagtgagtagtctccttttgtct 21453289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 28216236 - 28216202
Alignment:
151 cattaggtagctcatccttgtgatgagtgagtagt 185  Q
    ||||||||||||||||||| |||||||||||||||    
28216236 cattaggtagctcatccttatgatgagtgagtagt 28216202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University