View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10701_low_20 (Length: 213)

Name: NF10701_low_20
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10701_low_20
NF10701_low_20
[»] chr7 (2 HSPs)
chr7 (17-78)||(36047513-36047574)
chr7 (144-194)||(36047397-36047447)


Alignment Details
Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 17 - 78
Target Start/End: Complemental strand, 36047574 - 36047513
Alignment:
17 aaggtattgtaattcaattctattctatgtggaatatgattagtgattaattgcatatttaa 78  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
36047574 aaggtattgtaattcaattcaattctatgtggaatatgattagtgattaattgcatatttaa 36047513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 36047447 - 36047397
Alignment:
144 tcataaatgcttacctttatgtgatgttaattttgttaggttgttgatact 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
36047447 tcataaatgcttacctttatgtgatgttaattttgttaggttgttgatact 36047397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University