View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_low_20 (Length: 213)
Name: NF10701_low_20
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 17 - 78
Target Start/End: Complemental strand, 36047574 - 36047513
Alignment:
| Q |
17 |
aaggtattgtaattcaattctattctatgtggaatatgattagtgattaattgcatatttaa |
78 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36047574 |
aaggtattgtaattcaattcaattctatgtggaatatgattagtgattaattgcatatttaa |
36047513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 36047447 - 36047397
Alignment:
| Q |
144 |
tcataaatgcttacctttatgtgatgttaattttgttaggttgttgatact |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36047447 |
tcataaatgcttacctttatgtgatgttaattttgttaggttgttgatact |
36047397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University