View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_low_21 (Length: 210)
Name: NF10701_low_21
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 10366976 - 10367152
Alignment:
| Q |
15 |
cacagaccctaagtaatttagtttaattttccatttttatttctagttttcttgcttgtacaccacttttgaataggtactataaataatannnnnnnga |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10366976 |
cacagaccctaagtaatttagtttaattttccatttttatttctagttttcttgcttgtacaccacttttgaataggtactataaataatatttttttga |
10367075 |
T |
|
| Q |
115 |
gaaatgaaagtatataattatgatttctgttgactgatattgatagtttgagtttcaatgtgtcaaaatgtagtgtc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10367076 |
gaaatgaaagtatataattatgatttctgttgactgatattgatagtttgagtttcaatgtgtcaaaatgtagtgtc |
10367152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University