View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10701_low_8 (Length: 337)
Name: NF10701_low_8
Description: NF10701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10701_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 16 - 326
Target Start/End: Complemental strand, 47234819 - 47234509
Alignment:
| Q |
16 |
ttagaagcaacagcataacctatgtcagctttgcacctatcatcacctgaccaaggatacacagaaacaaaaccgatggaatggtcgtcgagacagattg |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234819 |
ttagaagcaacagcataacccatgtcagctttgcacctatcatcacctgaccaaggatacactgaaacaaaaccgatggaatggtcgtcgagacagattg |
47234720 |
T |
 |
| Q |
116 |
aacgacgccaagggtgaggtatgcagacatctttgatgaaagtttgagcttcttcccttgaattgcaagttttccatcggatgttttttgttacttcatc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234719 |
aacgacgccaagggtgaggtatgcagacatctttgatgaaagtttgagcttcttcccttgaattgcaagttttccatcggatgttttttgttacttcatc |
47234620 |
T |
 |
| Q |
216 |
gtcccctgcccataacatgaaattgtcaacgtctgttggcttgaatggcctcagagatatcctagatagatccacctttgccatgttggtcaaatgatca |
315 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47234619 |
gtcccctgcccataacatgaaatcgtcaacgtctgttagcttgaatggcctcagagatatcctagatagatccacctttgccatgttggtcaaatgatca |
47234520 |
T |
 |
| Q |
316 |
ttgttattctt |
326 |
Q |
| |
|
||||||||||| |
|
|
| T |
47234519 |
ttgttattctt |
47234509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University