View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10702_high_13 (Length: 283)
Name: NF10702_high_13
Description: NF10702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10702_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 7 - 270
Target Start/End: Original strand, 38265451 - 38265714
Alignment:
| Q |
7 |
gctataacacctctcgatgtactcaaagtcaacatgcaagtcaatccagaaaaatacaagaacaatggaattctctccggcattgccaccatttggaaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265451 |
gctataacacctctcgatgtactcaaagtcaacatgcaagtcaatccagaaaaatacaagaacaatggaattctctccggcattgccaccatttggaaag |
38265550 |
T |
 |
| Q |
107 |
aggaaggttcttatgctctttggagaggttggtctggcaaattatgtggatatggtattcaaggagggttcaaatacggtctttatgagtatttcaaaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265551 |
aggaaggttcttatgctctttggagaggttggtctggcaaattatgtggatatggtattcaaggagggttcaaatacggtctttatgagtatttcaaaaa |
38265650 |
T |
 |
| Q |
207 |
cttctatgccgccgacgatgatcgtgcattgattaagcttaatagaaattctatattctttctc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38265651 |
cttctatgccgccgacgatgatcgtgcattgattaagcttaatagaaattctatattctttctc |
38265714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University