View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10702_high_15 (Length: 271)
Name: NF10702_high_15
Description: NF10702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10702_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 38216071 - 38215815
Alignment:
| Q |
1 |
caagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagattaacatgtcttcttgttattcactattcgtttccaagttgaaggaggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38216071 |
caagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagatcaacatgtcttcttgttattcactattcgtttccaagttgaaggaggag |
38215972 |
T |
|
| Q |
101 |
aaaaagcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttctaacaacttcttttctgcttgatcaaataagtcgatcattg |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215971 |
aaaaggcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttctaacaacttcttttctgcttgatcaaataagtcgatcattg |
38215872 |
T |
|
| Q |
201 |
atataatttacttactttgtttgctgtaatttgtttttattttatggtcttctagtt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38215871 |
atataatttacttactttgtttgctgtaatttgtttttattttatggtcttctagtt |
38215815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University