View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10702_high_17 (Length: 250)
Name: NF10702_high_17
Description: NF10702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10702_high_17 |
 |  |
|
| [»] scaffold0343 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 6 - 214
Target Start/End: Original strand, 962290 - 962498
Alignment:
| Q |
6 |
agtttagttcacttactaaaaaataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcaccacctttaaggtgaatttat |
105 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||| ||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
962290 |
agtttagttcacttactaaggaataatgcatgttatatgcaggggttggggttcgaactccggacaccctacttattcatcatctttaaggtgaatttat |
962389 |
T |
 |
| Q |
106 |
caagtcgatggattatttgacaaaaataaattaatactcctacttttctttatcaaaatattaatagttgtaccaacgtgatgtgttacacaagtaatag |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
962390 |
caagtcgatgggttatttgacaaaaataaattaatactcttacttttctttatcaaaatactaatagttgtaccaacgtgatgtgttacacaagtaatag |
962489 |
T |
 |
| Q |
206 |
atacttgta |
214 |
Q |
| |
|
||||||||| |
|
|
| T |
962490 |
atacttgta |
962498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 32158475 - 32158427
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
|||||||||||||| |||| |||||| ||||||| || ||||||||||| |
|
|
| T |
32158475 |
ttatatgcaggggccggggttcgaaccccgaacaccccacttattcacc |
32158427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 40384285 - 40384333
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||| || ||||||||||| |
|
|
| T |
40384285 |
ttatatgcagcggctggggttcgaactccggacaccccacttattcacc |
40384333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 20610771 - 20610821
Alignment:
| Q |
36 |
tgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||| ||||||||||| |
|
|
| T |
20610771 |
tgttatatgcaggggccggggttcgaactccggacatcccacttattcacc |
20610821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 83
Target Start/End: Original strand, 18497424 - 18497471
Alignment:
| Q |
36 |
tgttatatgcaggggctggggatcgaactccgaacatcctacttattc |
83 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| |||||| |||||||| |
|
|
| T |
18497424 |
tgttatatgcaggggttggggttcgaactccggacatcccacttattc |
18497471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 36008307 - 36008357
Alignment:
| Q |
36 |
tgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
|||||||||||||||| |||| |||||| ||||||| || ||||||||||| |
|
|
| T |
36008307 |
tgttatatgcaggggccggggttcgaaccccgaacaccccacttattcacc |
36008357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 82
Target Start/End: Original strand, 42432040 - 42432086
Alignment:
| Q |
36 |
tgttatatgcaggggctggggatcgaactccgaacatcctacttatt |
82 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
42432040 |
tgttatatgcagggattggggttcgaactccgaacaccctacttatt |
42432086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 54854240 - 54854192
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||||| ||||||||||| |
|
|
| T |
54854240 |
ttatatgcaggggctggggttcgaaccccggacatcacacttattcacc |
54854192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 42271076 - 42271026
Alignment:
| Q |
36 |
tgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||| |||||||||||||| |
|
|
| T |
42271076 |
tgttatatgcaggggccggggttcgaactccggacaccctacttattcacc |
42271026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 103
Target Start/End: Original strand, 27394532 - 27394603
Alignment:
| Q |
28 |
ataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcaccacctttaaggtgaattt |
103 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||| ||| ||| || ||||||| |||||||||||||||||| |
|
|
| T |
27394532 |
ataatgcat-ttatatgcaggggctggggtttgaaccccggacaccccacttatt---cacctttaaggtgaattt |
27394603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 33206791 - 33206839
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||| || ||||||||||| |
|
|
| T |
33206791 |
ttatatgcaggggctggggttcgaaccccggacaccccacttattcacc |
33206839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 46006473 - 46006429
Alignment:
| Q |
30 |
aatgcatgttatatgcaggggctggggatcgaactccgaacatcc |
74 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
46006473 |
aatgcatattatatgcagggggtggggttcgaactccggacatcc |
46006429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 47191407 - 47191455
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
||||||||||||||||| | |||||| ||||||| || ||||||||||| |
|
|
| T |
47191407 |
ttatatgcaggggctggagttcgaaccccgaacaccccacttattcacc |
47191455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 84
Target Start/End: Complemental strand, 8740717 - 8740671
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattca |
84 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||| |||||||||||| |
|
|
| T |
8740717 |
ttatatgcaggggctgaggttcgaactccggacaccctacttattca |
8740671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 10970300 - 10970348
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
||||||||||||||||||| || ||| ||||||| || ||||||||||| |
|
|
| T |
10970300 |
ttatatgcaggggctggggttcaaaccccgaacaccccacttattcacc |
10970348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 8176028 - 8176078
Alignment:
| Q |
36 |
tgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||| || ||||||||||| |
|
|
| T |
8176028 |
tgttatatgcagggactggtgttcgaactccgaacaccccacttattcacc |
8176078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 6455487 - 6455535
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
||||||| | ||||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
6455487 |
ttatatgtatgggctggggttcgaactccggacaccctacttattcacc |
6455535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 42946538 - 42946480
Alignment:
| Q |
28 |
ataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||| ||| ||| || ||||||||||| |
|
|
| T |
42946538 |
ataatgcatattatatgcaggggctggggtttgaaccccggacaccccacttattcacc |
42946480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 103
Target Start/End: Original strand, 19424070 - 19424142
Alignment:
| Q |
28 |
ataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcaccacctttaaggtgaattt |
103 |
Q |
| |
|
||||||||| ||||||||||||| |||| |||||| ||| ||| || ||||||| |||||||||||||||||| |
|
|
| T |
19424070 |
ataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttatt---cacctttaaggtgaattt |
19424142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 3341797 - 3341749
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| ||| || ||||||||||| |
|
|
| T |
3341797 |
ttatatgcaggggccggggatcgaaccccggacaccccacttattcacc |
3341749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 20101693 - 20101644
Alignment:
| Q |
30 |
aatgcatgttatatgcaggggctggggatcgaactccgaacatcctactt |
79 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||||||| ||| ||||||| |
|
|
| T |
20101693 |
aatgcatattatatgcaggggccggggttcgaactccggacaccctactt |
20101644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 84
Target Start/End: Complemental strand, 10020532 - 10020484
Alignment:
| Q |
36 |
tgttatatgcaggggctggggatcgaactccgaacatcctacttattca |
84 |
Q |
| |
|
||||||||||||||| ||||| |||||| ||||||| || ||||||||| |
|
|
| T |
10020532 |
tgttatatgcaggggttggggttcgaaccccgaacaacccacttattca |
10020484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 103
Target Start/End: Original strand, 43684303 - 43684374
Alignment:
| Q |
28 |
ataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcaccacctttaaggtgaattt |
103 |
Q |
| |
|
||||||||| || ||||||||||||| || |||||| ||||||| || ||||||| |||||||||||||||||| |
|
|
| T |
43684303 |
ataatgcat-ttgtatgcaggggctgaggttcgaaccccgaacaccccacttatt---cacctttaaggtgaattt |
43684374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 18386873 - 18386825
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
||||||| ||||||||||| |||||||||| ||| || ||||||||||| |
|
|
| T |
18386873 |
ttatatgtaggggctggggttcgaactccggacaccccacttattcacc |
18386825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0343 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0343
Description:
Target: scaffold0343; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 8594 - 8642
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
||||||| ||||| ||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
8594 |
ttatatgtaggggttggggttcgaaccccgaacaccctacttattcacc |
8642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 101865 - 101913
Alignment:
| Q |
38 |
ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc |
86 |
Q |
| |
|
|||||||||||||| |||| |||||| || ||||||| ||||||||||| |
|
|
| T |
101865 |
ttatatgcaggggccggggttcgaaccccaaacatcccacttattcacc |
101913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University