View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10702_high_17 (Length: 250)

Name: NF10702_high_17
Description: NF10702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10702_high_17
NF10702_high_17
[»] chr5 (3 HSPs)
chr5 (6-214)||(962290-962498)
chr5 (38-86)||(32158427-32158475)
chr5 (38-86)||(40384285-40384333)
[»] chr4 (5 HSPs)
chr4 (36-86)||(20610771-20610821)
chr4 (36-83)||(18497424-18497471)
chr4 (36-86)||(36008307-36008357)
chr4 (36-82)||(42432040-42432086)
chr4 (38-86)||(54854192-54854240)
[»] chr3 (5 HSPs)
chr3 (36-86)||(42271026-42271076)
chr3 (28-103)||(27394532-27394603)
chr3 (38-86)||(33206791-33206839)
chr3 (30-74)||(46006429-46006473)
chr3 (38-86)||(47191407-47191455)
[»] chr8 (2 HSPs)
chr8 (38-84)||(8740671-8740717)
chr8 (38-86)||(10970300-10970348)
[»] chr6 (2 HSPs)
chr6 (36-86)||(8176028-8176078)
chr6 (38-86)||(6455487-6455535)
[»] chr1 (3 HSPs)
chr1 (28-86)||(42946480-42946538)
chr1 (28-103)||(19424070-19424142)
chr1 (38-86)||(3341749-3341797)
[»] chr7 (2 HSPs)
chr7 (30-79)||(20101644-20101693)
chr7 (36-84)||(10020484-10020532)
[»] chr2 (2 HSPs)
chr2 (28-103)||(43684303-43684374)
chr2 (38-86)||(18386825-18386873)
[»] scaffold0343 (1 HSPs)
scaffold0343 (38-86)||(8594-8642)
[»] scaffold0039 (1 HSPs)
scaffold0039 (38-86)||(101865-101913)


Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 6 - 214
Target Start/End: Original strand, 962290 - 962498
Alignment:
6 agtttagttcacttactaaaaaataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcaccacctttaaggtgaatttat 105  Q
    |||||||||||||||||||  |||||||||||||||||||||||| ||||| |||||||||| ||| |||||||||||| || |||||||||||||||||    
962290 agtttagttcacttactaaggaataatgcatgttatatgcaggggttggggttcgaactccggacaccctacttattcatcatctttaaggtgaatttat 962389  T
106 caagtcgatggattatttgacaaaaataaattaatactcctacttttctttatcaaaatattaatagttgtaccaacgtgatgtgttacacaagtaatag 205  Q
    ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
962390 caagtcgatgggttatttgacaaaaataaattaatactcttacttttctttatcaaaatactaatagttgtaccaacgtgatgtgttacacaagtaatag 962489  T
206 atacttgta 214  Q
    |||||||||    
962490 atacttgta 962498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 32158475 - 32158427
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    |||||||||||||| |||| |||||| ||||||| || |||||||||||    
32158475 ttatatgcaggggccggggttcgaaccccgaacaccccacttattcacc 32158427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 40384285 - 40384333
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    |||||||||| |||||||| |||||||||| ||| || |||||||||||    
40384285 ttatatgcagcggctggggttcgaactccggacaccccacttattcacc 40384333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 20610771 - 20610821
Alignment:
36 tgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    |||||||||||||||| |||| |||||||||| |||||| |||||||||||    
20610771 tgttatatgcaggggccggggttcgaactccggacatcccacttattcacc 20610821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 36 - 83
Target Start/End: Original strand, 18497424 - 18497471
Alignment:
36 tgttatatgcaggggctggggatcgaactccgaacatcctacttattc 83  Q
    ||||||||||||||| ||||| |||||||||| |||||| ||||||||    
18497424 tgttatatgcaggggttggggttcgaactccggacatcccacttattc 18497471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 36008307 - 36008357
Alignment:
36 tgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    |||||||||||||||| |||| |||||| ||||||| || |||||||||||    
36008307 tgttatatgcaggggccggggttcgaaccccgaacaccccacttattcacc 36008357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 82
Target Start/End: Original strand, 42432040 - 42432086
Alignment:
36 tgttatatgcaggggctggggatcgaactccgaacatcctacttatt 82  Q
    ||||||||||||||  ||||| |||||||||||||| ||||||||||    
42432040 tgttatatgcagggattggggttcgaactccgaacaccctacttatt 42432086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 54854240 - 54854192
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    ||||||||||||||||||| |||||| ||| |||||  |||||||||||    
54854240 ttatatgcaggggctggggttcgaaccccggacatcacacttattcacc 54854192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 36 - 86
Target Start/End: Complemental strand, 42271076 - 42271026
Alignment:
36 tgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    |||||||||||||||| |||| |||||||||| ||| ||||||||||||||    
42271076 tgttatatgcaggggccggggttcgaactccggacaccctacttattcacc 42271026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 103
Target Start/End: Original strand, 27394532 - 27394603
Alignment:
28 ataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcaccacctttaaggtgaattt 103  Q
    ||||||||| ||||||||||||||||||| | |||| ||| ||| || |||||||   ||||||||||||||||||    
27394532 ataatgcat-ttatatgcaggggctggggtttgaaccccggacaccccacttatt---cacctttaaggtgaattt 27394603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 33206791 - 33206839
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    ||||||||||||||||||| |||||| ||| ||| || |||||||||||    
33206791 ttatatgcaggggctggggttcgaaccccggacaccccacttattcacc 33206839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 74
Target Start/End: Complemental strand, 46006473 - 46006429
Alignment:
30 aatgcatgttatatgcaggggctggggatcgaactccgaacatcc 74  Q
    ||||||| ||||||||||||| ||||| |||||||||| ||||||    
46006473 aatgcatattatatgcagggggtggggttcgaactccggacatcc 46006429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 47191407 - 47191455
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    ||||||||||||||||| | |||||| ||||||| || |||||||||||    
47191407 ttatatgcaggggctggagttcgaaccccgaacaccccacttattcacc 47191455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 84
Target Start/End: Complemental strand, 8740717 - 8740671
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattca 84  Q
    |||||||||||||||| || |||||||||| ||| ||||||||||||    
8740717 ttatatgcaggggctgaggttcgaactccggacaccctacttattca 8740671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 10970300 - 10970348
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    ||||||||||||||||||| || ||| ||||||| || |||||||||||    
10970300 ttatatgcaggggctggggttcaaaccccgaacaccccacttattcacc 10970348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 8176028 - 8176078
Alignment:
36 tgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    |||||||||||||| |||| | |||||||||||||| || |||||||||||    
8176028 tgttatatgcagggactggtgttcgaactccgaacaccccacttattcacc 8176078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 6455487 - 6455535
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    ||||||| | ||||||||| |||||||||| ||| ||||||||||||||    
6455487 ttatatgtatgggctggggttcgaactccggacaccctacttattcacc 6455535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 86
Target Start/End: Complemental strand, 42946538 - 42946480
Alignment:
28 ataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    ||||||||| ||||||||||||||||||| | |||| ||| ||| || |||||||||||    
42946538 ataatgcatattatatgcaggggctggggtttgaaccccggacaccccacttattcacc 42946480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 103
Target Start/End: Original strand, 19424070 - 19424142
Alignment:
28 ataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcaccacctttaaggtgaattt 103  Q
    ||||||||| |||||||||||||  |||| |||||| ||| ||| || |||||||   ||||||||||||||||||    
19424070 ataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttatt---cacctttaaggtgaattt 19424142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 3341797 - 3341749
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    |||||||||||||| ||||||||||| ||| ||| || |||||||||||    
3341797 ttatatgcaggggccggggatcgaaccccggacaccccacttattcacc 3341749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 20101693 - 20101644
Alignment:
30 aatgcatgttatatgcaggggctggggatcgaactccgaacatcctactt 79  Q
    ||||||| |||||||||||||| |||| |||||||||| ||| |||||||    
20101693 aatgcatattatatgcaggggccggggttcgaactccggacaccctactt 20101644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 84
Target Start/End: Complemental strand, 10020532 - 10020484
Alignment:
36 tgttatatgcaggggctggggatcgaactccgaacatcctacttattca 84  Q
    ||||||||||||||| ||||| |||||| ||||||| || |||||||||    
10020532 tgttatatgcaggggttggggttcgaaccccgaacaacccacttattca 10020484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 103
Target Start/End: Original strand, 43684303 - 43684374
Alignment:
28 ataatgcatgttatatgcaggggctggggatcgaactccgaacatcctacttattcaccacctttaaggtgaattt 103  Q
    ||||||||| || ||||||||||||| || |||||| ||||||| || |||||||   ||||||||||||||||||    
43684303 ataatgcat-ttgtatgcaggggctgaggttcgaaccccgaacaccccacttatt---cacctttaaggtgaattt 43684374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Complemental strand, 18386873 - 18386825
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    ||||||| ||||||||||| |||||||||| ||| || |||||||||||    
18386873 ttatatgtaggggctggggttcgaactccggacaccccacttattcacc 18386825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0343 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0343
Description:

Target: scaffold0343; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 8594 - 8642
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    ||||||| ||||| ||||| |||||| ||||||| ||||||||||||||    
8594 ttatatgtaggggttggggttcgaaccccgaacaccctacttattcacc 8642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0039 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0039
Description:

Target: scaffold0039; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 86
Target Start/End: Original strand, 101865 - 101913
Alignment:
38 ttatatgcaggggctggggatcgaactccgaacatcctacttattcacc 86  Q
    |||||||||||||| |||| |||||| || ||||||| |||||||||||    
101865 ttatatgcaggggccggggttcgaaccccaaacatcccacttattcacc 101913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University