View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10702_high_5 (Length: 387)
Name: NF10702_high_5
Description: NF10702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10702_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 19 - 380
Target Start/End: Original strand, 32240267 - 32240630
Alignment:
| Q |
19 |
aaaaggtgttaaacttttgtcagaaggtttgaaaattttgtcttttgttcagagattctgaaatccccctgttttaatttaattttcacttggattggtt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32240267 |
aaaaggtgttaaacttttgtcagaaggtttgaaaattttgtcttttgttcagagattctgaaacccccctgttttaatttaattttcacttggattggtt |
32240366 |
T |
 |
| Q |
119 |
gattaaacaatgcattttatctgtcnnnnnnncactataaattttacttcatttgctggaaatttctggtttagggtatatgtggtttctgcaaaaggta |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32240367 |
gattaaacaatgcattttatctgtctttttttcactataaattttacttcatttgctggaaatttctggtttagggtatatgtggtttctgcaaaaggta |
32240466 |
T |
 |
| Q |
219 |
attaccatgtgtcaggaagtttgaaactattggcaatgggtcagagatactgatttttcccttcttttcttttaattgattctgacactgcgtgtataaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32240467 |
attaccatgtgtcaggaagtttgaaactattggcaatgggtcagagatactgatttttcccttcttttcttttaattgattctgacactgcgtgtataaa |
32240566 |
T |
 |
| Q |
319 |
agatgaaattcata--tgccctttttctctataaaatggtgcttgctgtgttcatttcatctca |
380 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32240567 |
agatgaaattcatatgtgccctttttctctataaaatggtgcttgctgtgttcatttcatctca |
32240630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University