View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10702_low_13 (Length: 350)
Name: NF10702_low_13
Description: NF10702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10702_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 42453199 - 42453533
Alignment:
| Q |
1 |
ttgtacaaaaagtacacagtgccaatgctttttccacaacatttcgaggatccgctgtctcaagctcagttatacggattaaggcaacaaactatcgagc |
100 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453199 |
ttgtataaaaagtacacaatgccaatgctttttccacaacatttcgaggatccgctgtctcaagctcagttatacggattaaggcaacaaactatcgagc |
42453298 |
T |
 |
| Q |
101 |
ttgtgcggtcaaatatgagcaaagctgaaccgccgttgagaaatgaggttgttgattatatgctagattcacgtgaaatcgtgtggagtatgagaagatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453299 |
ttgtgcggtcaaatatgagcaaagctgaaccgccgttgagaaatgaggttgttgattatatgctagattcacgtgaaatcgtgtggagtatgagaagatg |
42453398 |
T |
 |
| Q |
201 |
taaagctgattttgagaggatcaacgtctttctaaattgcttggttggtatttacacttattttgatgacgtacgcaagtggaaagatcttgtttcacca |
300 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453399 |
taaagctgattttgagaggattaacgtctttctaaattgcttggttggtatttacacttattttgatgacgtacgcaagtggaaagatcttgtttcacca |
42453498 |
T |
 |
| Q |
301 |
attatagctcacttgttgctcgtcgtcttgttctt |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42453499 |
attatagctcacttgttgctcgtcgtcttgttctt |
42453533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University