View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10702_low_14 (Length: 332)
Name: NF10702_low_14
Description: NF10702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10702_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 16 - 316
Target Start/End: Original strand, 32375080 - 32375380
Alignment:
| Q |
16 |
aataagaacagtgtccttgcttgcaaataaatctgacgattgttgatcatagaatctattggaaaatgcgtctaacacacgctcaatcttttgcgactcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32375080 |
aataagaacagtgtccttgcttgcaaataaatctgacgattgttgatcatagaatctattggaaaacgcgtctaacacacgctcaatcttttgcgactcg |
32375179 |
T |
|
| Q |
116 |
cctggcaaccaaaaactttcaagaaaaaatctcaatccagtgtcaagaaccataccattaaaatgaaaagtttctgtaaactccctaagaacttcgaggt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32375180 |
cctggcaaccaaaaactttcaagaaaaaatctcaatccagtgtcaagaaccataccattaaaatgaaaagtttctgtaaactccctaagaacttcgaggt |
32375279 |
T |
|
| Q |
216 |
aaaaactatcagggtcaccaagatattcgccgagcgcctttttgtctagaccaggtgtgaaccggaagaagtaagcatacgacttcggatcaggaggatc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32375280 |
aaaaactatcagggtcaccaagatattcgccgagcgcctttttgtctagaccaggtgtgaaccggaagaagtaagcatacgacttcggatcaggaggatc |
32375379 |
T |
|
| Q |
316 |
g |
316 |
Q |
| |
|
| |
|
|
| T |
32375380 |
g |
32375380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University