View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10704_low_1 (Length: 284)
Name: NF10704_low_1
Description: NF10704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10704_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 7 - 272
Target Start/End: Complemental strand, 33406283 - 33406018
Alignment:
| Q |
7 |
aatacaacttaatgagtttgaaaatatgtaatatatggaagagaatgtataaaaaattatgtgaaggtgaaagggattttatactaagcatgggaatgta |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33406283 |
aatacaactttatgagtttgaaaatatgtaatatatggaagagaatgtataaaaaattatgtgaaggtgaaagggaatttatactaagcatgggaatgta |
33406184 |
T |
|
| Q |
107 |
aatatgtaataaaggggtcaaaattaaagaaagagaaataattggttaagtctatgtggcaatcacggttatgcatcaattaatttagagtatagttttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33406183 |
aatatgtaataaaggggtcaaaattaaagaaagagaaataattggttaagtctatgtggcaatcacggttatgcatcaattaatttagagtatagttttg |
33406084 |
T |
|
| Q |
207 |
gcgtatattcatgggatttgtctaatatgtagccggctctctatgttaagatgagtctataaccta |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33406083 |
gcgtatattcatgggatttgtctaatatgtagccggctctctatgttaagatgagtctataaccta |
33406018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University