View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10705_low_12 (Length: 227)
Name: NF10705_low_12
Description: NF10705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10705_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 52806880 - 52807106
Alignment:
| Q |
1 |
gttgttggtaacctattaagagctacattgaaacaaagctcaagagctctagattgaagtggatgttgtgaagtttgatggtgaggctgatgagacttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52806880 |
gttgttggtaacctattaagagctacattgaaacaaagctcaagagccctagattgaagtggatgttgtgaagtttgatggtgaggctgatgagacttaa |
52806979 |
T |
 |
| Q |
101 |
gacaagctcttttgaaggaacttagtcttaaggtaagtaaagtgatggctacatgtagaggagtgacttgtggatgacctcgccttctagccaacacaag |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52806980 |
gacaagcccttttgaaggaacttagtcttaaggtaagtaaagtgatggctacatgtagaggagtgacttgtggatgacctcgccttctagccaacacaag |
52807079 |
T |
 |
| Q |
201 |
agaatgcttcaaaactgaagcagcctc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
52807080 |
agaatgcttcaaaactgaagcagcctc |
52807106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 16611286 - 16611234
Alignment:
| Q |
13 |
ctattaagagctacattgaaacaaagctcaagagctctagattgaagtggatg |
65 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||||||| ||||||| ||||| |
|
|
| T |
16611286 |
ctattaagagcaacattgaagcaaagttcaagagctctacattgaagaggatg |
16611234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University