View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10705_low_3 (Length: 342)
Name: NF10705_low_3
Description: NF10705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10705_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 52807107 - 52807364
Alignment:
| Q |
1 |
tgctgtgagggtctgctgcaatgcacaacctcctgagcgcatcacttgatatatacacaccccctatacacttccctctttgtctttggaagctagttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807107 |
tgctgtgagggtctgctgcaatgcacaacctcctgagcgcatcacttgatatatacacaccccctatacacttccctctttgtctttggaagctagttta |
52807206 |
T |
 |
| Q |
101 |
gtttagttactctcttttgtttttctatcaaagaaacgtggaactagcttaaagagtttcaatgagtgagagagaatgaaagagctctagtaaacaggct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807207 |
gtttagttactctcttttgtttttctatcaaagaaacgtggaactagcttaaagagtttcaatgagtgagagagaatgaaagagctctagtaaacaggct |
52807306 |
T |
 |
| Q |
201 |
ttagaaataacaataactatgcctcactgctttctttatagttcttgtcactcatcac |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52807307 |
ttagaaataacaataactatgcctcactgctttctttatagttcttgtcactcatcac |
52807364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University