View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10705_low_4 (Length: 262)
Name: NF10705_low_4
Description: NF10705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10705_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 9334503 - 9334321
Alignment:
| Q |
1 |
gatgatatgagacacaccattgggtttacgcacaaaacttggcgatatggaaatttaatctcttattattatatcctgacagcatgacggtgaaactggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9334503 |
gatgatatgagacacaccattgggtttacgcacaaaacttggcgatatggaaatttaatctcttattattatatcctgacagcatgacggtgaaactggc |
9334404 |
T |
|
| Q |
101 |
aaaagtgttatatttccaagaagacttgtattttgtttcaattctcagtatac---tactcatgtttgatatattgaaaatag |
180 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9334403 |
aaaattgttatatttccaagaagacttgtattttgtttcaattctcagtatactactactcatgtttgatatattgaaaatag |
9334321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 89 - 169
Target Start/End: Complemental strand, 9329068 - 9328989
Alignment:
| Q |
89 |
ggtgaaactggcaaaagtgttatatttccaagaagacttgt-attttgtttcaattctcagtatactactcatgtttgatat |
169 |
Q |
| |
|
||||||| |||||||||| |||| ||||||| ||||||||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
9329068 |
ggtgaaattggcaaaagttttatttttccaacaagacttgttattttgtttcaattctga--atactactcatgtttgatat |
9328989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University