View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10705_low_5 (Length: 260)
Name: NF10705_low_5
Description: NF10705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10705_low_5 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 51 - 205
Target Start/End: Original strand, 44867248 - 44867402
Alignment:
| Q |
51 |
gtttggattctaaaatttgaaatgttaacgtgttttggagggtatcacgggnnnnnnnngccgttcagattctataatccgagttgtatagagtgcatga |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44867248 |
gtttggattctaaaatttgaaatgttaacgtgttttggagggtatcacgggttttttttgccgttcagattctataatccgagctgtatagagtgcatga |
44867347 |
T |
|
| Q |
151 |
taaattaaataggatgggaaaagtttatggctatttctttttcacattgtttctt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44867348 |
taaattaaataggatgggaaaagtttatggctatttcttttccacattgtttctt |
44867402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 44870035 - 44870000
Alignment:
| Q |
19 |
tttctgttatcacttattatcaatcctttaaagttt |
54 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44870035 |
tttctgttataacttattatcaatcctttaaagttt |
44870000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 182 - 260
Target Start/End: Complemental strand, 32487854 - 32487776
Alignment:
| Q |
182 |
tatttctttttcacattgtttcttaatcatcatgttattacaaaatgccgcctaatcaagatcttccatccctgtttct |
260 |
Q |
| |
|
|||||||| |||| ||||| | ||||||||||||||| | ||| ||| ||||||| ||||||||||||| ||| |||| |
|
|
| T |
32487854 |
tatttcttgttcatattgtgacataatcatcatgttatgaaaaattgcagcctaattaagatcttccatctctgcttct |
32487776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University