View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10705_low_6 (Length: 253)
Name: NF10705_low_6
Description: NF10705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10705_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 33652024 - 33651795
Alignment:
| Q |
17 |
cataaaaagttgaaaccaaccaagttcattctatagcatgtcctacatatatcagaaaaccatgtgagaagacacttgcattacattacatatttttatt |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33652024 |
cataaaaagttgaaaccaacaaagttcattctatagcatgtcctacatatatcagaaaaccatgtgagaagacacttgcattacattacatatttttatt |
33651925 |
T |
|
| Q |
117 |
tttnnnnnnnn-cattattatcaaattaaattttaatagttctcacaaacttgcattggcagaatgagttttgcatgatcatccactatagttaagaaat |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33651924 |
tttaaaaaaaaacattattatcaaattaaattttaatagttctcacaaacttgcattggcagaatgagttttgcataatcatccactatagttaagaaat |
33651825 |
T |
|
| Q |
216 |
aatttggtaaatatgaatgtctctgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33651824 |
aatttggtaaatatgaatgtctctgcttct |
33651795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University