View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10706_high_11 (Length: 257)
Name: NF10706_high_11
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10706_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 24355163 - 24355402
Alignment:
| Q |
1 |
aatggagtgtgaagtgcactgcagaaggaatagatggaggaatgtttgtgggaaggaaaagtagagaaaatggtattgttgttagtattgctgagaggta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
24355163 |
aatggagtgtgaagtgcactgcagaaggaatagatggaggaatgtttgtgggaaggaaaagtagagaaaatggcattgttgttagtattcctgagaggta |
24355262 |
T |
 |
| Q |
101 |
taaggttgtgttgttgttggcatgtgttatgtgtctttgtaatgctgatcgcgttgtcatgtcggttgctgttgttcctcttgctgctaaacatggttgg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24355263 |
taaggttgtgttattgttggcatgtgttatgtgtctttgtaacgctgaccgtgttgtcatgtcggttgctgttgttcctcttgctgctaaacatggttgg |
24355362 |
T |
 |
| Q |
201 |
tctagttctttccttggcattgttcaggtaccaataatat |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24355363 |
tctagttcttttcttggcattgttcaggtaccaataatat |
24355402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University