View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10706_low_15 (Length: 259)

Name: NF10706_low_15
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10706_low_15
NF10706_low_15
[»] chr4 (2 HSPs)
chr4 (17-246)||(43435159-43435388)
chr4 (17-168)||(43426732-43426883)
[»] scaffold0252 (1 HSPs)
scaffold0252 (17-246)||(20642-20868)


Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 43435388 - 43435159
Alignment:
17 ttcataaccctaatcatgaaattatccgaaagctgaattttaaccttctccagttcattctcaaccatatcatcccaatcagaccttgaaataatgccaa 116  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||    
43435388 ttcataaccctaatcacgaaattatccgaaagctgaattttaaccttctccagttcattctcaaccttatcatcccaatcagaccctgaaataatgccaa 43435289  T
117 ccacctttttgacaacattccgcattgcattttgctcaagcatccctttataacaatatggaagcacaacaacatcactccacaactcctccctttttaa 216  Q
    |||||||||| ||||||||| |||||||||||||||||||||||||||||||  ||| || |||  |||||| |||||||  ||| | ||||||||| ||    
43435288 ccacctttttaacaacattctgcattgcattttgctcaagcatccctttatagaaatgtgaaagtgcaacaatatcactcttcaaattctcccttttcaa 43435189  T
217 actcgtcgaaatcgtcaaatgtgtctcttc 246  Q
    || ||| |||||||||||||  ||||||||    
43435188 acccgtagaaatcgtcaaatacgtctcttc 43435159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 17 - 168
Target Start/End: Complemental strand, 43426883 - 43426732
Alignment:
17 ttcataaccctaatcatgaaattatccgaaagctgaattttaaccttctccagttcattctcaaccatatcatcccaatcagaccttgaaataatgccaa 116  Q
    |||||||||||||||| |||||| |||||||| ||||||||||||||||| ||||||||||||| |  ||  ||||||||||||| ||||||||| ||||    
43426883 ttcataaccctaatcacgaaattgtccgaaagttgaattttaaccttctcgagttcattctcaatctcattgtcccaatcagaccctgaaataataccaa 43426784  T
117 ccacctttttgacaacattccgcattgcattttgctcaagcatccctttata 168  Q
    ||||||||||||||||| || |||||||||  ||||||||||||||||||||    
43426783 ccacctttttgacaacactctgcattgcatcctgctcaagcatccctttata 43426732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0252 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: scaffold0252
Description:

Target: scaffold0252; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 20868 - 20642
Alignment:
17 ttcataaccctaatcatgaaattatccgaaagctgaattttaaccttctccagttcattctcaaccatatcatcccaatcagaccttgaaataatgccaa 116  Q
    ||||| |||||||||| |||||||||||||||   ||||||||||||||||||||||||||||||| |||||||||||||||||| | || |||||||||    
20868 ttcatgaccctaatcacgaaattatccgaaag---aattttaaccttctccagttcattctcaaccttatcatcccaatcagacccttaagtaatgccaa 20772  T
117 ccacctttttgacaacattccgcattgcattttgctcaagcatccctttataacaatatggaagcacaacaacatcactccacaactcctccctttttaa 216  Q
    |||||||||||||||||||| |||||||||| ||||||||||||||||| ||  ||| || |||| ||||||||||||||  ||||| ||||| ||||||    
20771 ccacctttttgacaacattctgcattgcattctgctcaagcatccctttgtagaaatgtgaaagcgcaacaacatcactcttcaacttctccccttttaa 20672  T
217 actcgtcgaaatcgtcaaatgtgtctcttc 246  Q
    |||| | |||||||||| ||||||||||||    
20671 actccttgaaatcgtcacatgtgtctcttc 20642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University