View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10706_low_17 (Length: 252)
Name: NF10706_low_17
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10706_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 243; Significance: 1e-135; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 176064 - 176306
Alignment:
| Q |
1 |
tcgcaactcatgggtatacccgaagggaatgttggcaaatttgtaagtggcagcgttcattgggccattgaagatcaaaataaccgattcctaaaatcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176064 |
tcgcaactcatgggtatacccgaagggaatgttggcaaatttgtaagtggcagcgttcattgggccattgaagatcaaaataaccgattcctaaaatcac |
176163 |
T |
|
| Q |
101 |
aagatccagatgaccactcttcatggtcatggcacattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtctacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176164 |
aagatccagatgaccactcttcatggtcatggcacattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtctacc |
176263 |
T |
|
| Q |
201 |
tctgcataacttcagcttgggggtttctagggattgcctatgc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
176264 |
tctgcataacttcagcttgggggtttctagggattgcctatgc |
176306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 1459734 - 1459628
Alignment:
| Q |
135 |
cattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtcta------cctctgcataacttcagcttgggggtttct |
228 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||| ||||||| ||||| |||||||| || |||||||||||||| ||||||||||||| | |
|
|
| T |
1459734 |
cattctttctcttgatttaggaaacgagtcttatcaagagattttgcagcctaattatggtttagatgaacctctgcataactttagcttgggggtttat |
1459635 |
T |
|
| Q |
229 |
agggatt |
235 |
Q |
| |
|
||||||| |
|
|
| T |
1459634 |
agggatt |
1459628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 135 - 235
Target Start/End: Complemental strand, 1471116 - 1471010
Alignment:
| Q |
135 |
cattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtcta------cctctgcataacttcagcttgggggtttct |
228 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||| ||||||| ||||| ||||||| | || ||||||| |||||| ||||||||||||||| |
|
|
| T |
1471116 |
cattctttctcttaatttaggaaacgagtcttatcaagagattttacagcctgattatgatttagatgaacctctgcgtaactttagcttgggggtttct |
1471017 |
T |
|
| Q |
229 |
agggatt |
235 |
Q |
| |
|
||||||| |
|
|
| T |
1471016 |
agggatt |
1471010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 135 - 197
Target Start/End: Original strand, 3926917 - 3926979
Alignment:
| Q |
135 |
cattctttctcttcatttaggaaatgagtcgtatcgggagatttcccagcccgattatggtct |
197 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||| |||||||| | |||||||| |||||| |
|
|
| T |
3926917 |
cattctttctcttgatttaggaaacgagtcctatcaagagatttcacggcccgattttggtct |
3926979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 3926826 - 3926898
Alignment:
| Q |
8 |
tcatgggtatacccgaagggaatgttggcaaatttgtaagtggcagcgttcattgggccattgaagatcaaaa |
80 |
Q |
| |
|
|||||||| ||||| | ||| ||||||| |||||||||||||||| || |||||||||| ||| ||||||| |
|
|
| T |
3926826 |
tcatgggtttacccaatgggtatgttgggaaatttgtaagtggcacaattaattgggccatagaaaatcaaaa |
3926898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University