View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10706_low_18 (Length: 251)
Name: NF10706_low_18
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10706_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 13 - 98
Target Start/End: Complemental strand, 22836348 - 22836263
Alignment:
| Q |
13 |
gaagaaagtaggtgtcaaaatcctttatctttcctttaaaaactaggttggtgggtatatcatcatatgcatatctaaattcatca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22836348 |
gaagaaagtaggtgtcaaaatcctttatctttcctttaaaaactaggttggtgggtatatcatcatatgcatatctaaattcatca |
22836263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 173 - 240
Target Start/End: Complemental strand, 22836187 - 22836120
Alignment:
| Q |
173 |
caataaaaagagggataaaaaggctgtcacaaaaaagttttttctctcatttttatatcactgttcat |
240 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22836187 |
caataaaaagagggaaaaaaagattgtcacaaaaaagttttttctctcatatttatatcactgttcat |
22836120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 89
Target Start/End: Complemental strand, 22846668 - 22846592
Alignment:
| Q |
13 |
gaagaaagtaggtgtcaaaatcctttatctttcctttaaaaactaggttggtgggtatatcatcatatgcatatcta |
89 |
Q |
| |
|
|||||| |||||| |||||| |||||||||||| | |||| ||||||||| |||||| | |||||||||||||| |
|
|
| T |
22846668 |
gaagaaggtaggtaccaaaatattttatctttcctatcaaaattaggttggtaggtatactaccatatgcatatcta |
22846592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University