View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10706_low_19 (Length: 251)
Name: NF10706_low_19
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10706_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 29216009 - 29216261
Alignment:
| Q |
1 |
tttctaaaataaatgcactcttannnnnnnaggggaaaatgtacttttaggggcactccatttattaccgtatatgcagcaaaccgtgtgaaattgaatt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29216009 |
tttctaaaataaatgcactcttatttttttaggggaaaatgtacttttaggggcactccatttattaccgtatatgcagcaaaccgtgtgaaattgcatt |
29216108 |
T |
|
| Q |
101 |
gaat------------aaataaaaagattcctttttacatttctctaaaaatgaaaatttccctttataaataaattatcccacaca--tggaaattcaa |
186 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
29216109 |
gaatccataaataaataaataaaaagattcttttttacatttctctaaaaatgaaaatttccctttataaataaattaccatacacatgtggaaattcaa |
29216208 |
T |
|
| Q |
187 |
ttttccaattcaaccaaccaaacaactccttaacacaaacatcactccccctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29216209 |
ttttccaattcaaccaaccaaacaactccttaacacaaacatcactctccctt |
29216261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University