View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10706_low_29 (Length: 222)
Name: NF10706_low_29
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10706_low_29 |
 | |
|
| [»] scaffold0066 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0066 (Bit Score: 146; Significance: 4e-77; HSPs: 3)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 33635 - 33431
Alignment:
| Q |
19 |
cggagacttttagacatcacggcatgcacctcagccttcaatggctccccaaaacccaaagagtatcagaatttggacaattctattacttcttttc--a |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
33635 |
cggagacttttagacatcacggcatgcacctcagccttcaatggctccccaaaacccaaagagtatcagaatttggacaattctatgacttcttttcata |
33536 |
T |
|
| Q |
117 |
ttttcccatcttacaccttcctttcaatgtcagtctaatctccaccactttcctttcaatctggttcatagctatgaa-----gataaggacaccggaca |
211 |
Q |
| |
|
|||||||| ||| ||||| ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33535 |
ttttcccacctttcacctccctttcaatgtcagtctaatctctactgctttcctttcaatctggttcatagctatgaagcacggataaggacaccggaca |
33436 |
T |
|
| Q |
212 |
cgaca |
216 |
Q |
| |
|
||||| |
|
|
| T |
33435 |
cgaca |
33431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 91 - 187
Target Start/End: Complemental strand, 31157 - 31061
Alignment:
| Q |
91 |
ttggacaattctattacttcttttcattttcccatcttacaccttcctttcaatgtcagtctaatctccaccactttcctttcaatctggttcatag |
187 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31157 |
ttggacaattctatgacttcttttcattttcccaccttacacctccctttcaatgtcagtctaatctccaatgctttcctttcaatctggttcatag |
31061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 79
Target Start/End: Complemental strand, 31278 - 31218
Alignment:
| Q |
19 |
cggagacttttagacatcacggcatgcacctcagccttcaatggctccccaaaacccaaag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31278 |
cggagacttttagacatcacggcatgcacctcaaccttcaatggctccccaaaacccaaag |
31218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University