View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10706_low_5 (Length: 434)
Name: NF10706_low_5
Description: NF10706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10706_low_5 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0252 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold1536 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0750 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |  |
|
| [»] scaffold0184 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
| [»] scaffold1665 (1 HSPs) |
 |  |  |
|
| [»] scaffold0740 (1 HSPs) |
 |  |  |
|
| [»] scaffold0260 (1 HSPs) |
 |  |  |
|
| [»] scaffold0235 (1 HSPs) |
 |  |  |
|
| [»] scaffold0225 (1 HSPs) |
 |  |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 12)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 244
Target Start/End: Original strand, 33169119 - 33169348
Alignment:
| Q |
14 |
gtggtgctggtggagctgttgaaactgaaggagttggatttgtaggagtgacggttccacttcctgttggtggtgggtaacatggatagggacaaggggt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33169119 |
gtggtgctggtggagctgttgaaactgaaggagttggatttgtaggagtgacggttccacttcctgtgggtggtgggtaacatggatagggacaaggggt |
33169218 |
T |
 |
| Q |
114 |
gtcggattttcttgtggttggaaaacagaggagtgttattgagaggaagaaaagaatggaagtggttgagtttaaagatagacatgtttggatggaatga |
213 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33169219 |
gtcggattttgttgtggctggaaaacagaggagtgttattgagaggaagaagagagtggaagtggttgag-ttaaagatagacatgtttggatggaatga |
33169317 |
T |
 |
| Q |
214 |
aaaagatggtaaaatgattgaaggaaatgaa |
244 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |
|
|
| T |
33169318 |
aaaagatggtaaaatgattaagggaaatgaa |
33169348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 241 - 393
Target Start/End: Original strand, 17086003 - 17086155
Alignment:
| Q |
241 |
tgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggttt |
340 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17086003 |
tgaataaaccggcgcattaggcctttatatagagcgctagaccggaccggttcaagaccggtctaatcccctgcgttgtgagcctttagatctagggttt |
17086102 |
T |
 |
| Q |
341 |
gggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17086103 |
gggatcttggatcaatccaacgatccctgagcgtctctgtgagatccgtatcc |
17086155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 238 - 397
Target Start/End: Complemental strand, 34194757 - 34194598
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
34194757 |
aaatgaaaaaaccggcgcattaggcttttatatagggcgctagaccggaccggttcaagaccggtccaaccccctgcgttgtgagcccttagatctaggg |
34194658 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttg |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34194657 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccggatcctttg |
34194598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 21964254 - 21964410
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21964254 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
21964353 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
21964354 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
21964410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 21979497 - 21979653
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21979497 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
21979596 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
21979597 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
21979653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 6558222 - 6558172
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
6558222 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg |
6558172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 319 - 362
Target Start/End: Original strand, 1894993 - 1895036
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
1894993 |
tgagcctttagatctagggtttggcttcctggatcaatccaacg |
1895036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 319 - 362
Target Start/End: Original strand, 1909794 - 1909837
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
1909794 |
tgagcctttagatctagggtttggcttcctggatcaatccaacg |
1909837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 319 - 368
Target Start/End: Original strand, 12784820 - 12784869
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccct |
368 |
Q |
| |
|
||||||||||||||||||||| || || ||||||||||||||| ||||| |
|
|
| T |
12784820 |
tgagcctttagatctagggttaggcttcctggatcaatccaacgctccct |
12784869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 321 - 362
Target Start/End: Complemental strand, 15652349 - 15652308
Alignment:
| Q |
321 |
agcctttagatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
15652349 |
agcctttagatctagggtttggcttcctggatcaatccaacg |
15652308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 310
Target Start/End: Complemental strand, 40465049 - 40465020
Alignment:
| Q |
281 |
accggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40465049 |
accggactggttcaagaccggtccaatccc |
40465020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 393
Target Start/End: Complemental strand, 15082627 - 15082515
Alignment:
| Q |
281 |
accggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtccctgt |
380 |
Q |
| |
|
||||||| ||||||| | |||||||| |||| | | || ||||||||||||||| ||| | || |||||| |||||||||||||||||| | || || |
|
|
| T |
15082627 |
accggaccggttcaattctggtccaattccctttgatctgcgcctttagatctaggtttttgcttcctggatcgatccaacgatccctgagctttcccgt |
15082528 |
T |
 |
| Q |
381 |
gagatccgtatcc |
393 |
Q |
| |
|
| |||||| |||| |
|
|
| T |
15082527 |
gtgatccggatcc |
15082515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 146; Significance: 9e-77; HSPs: 10)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 236 - 393
Target Start/End: Complemental strand, 16440730 - 16440573
Alignment:
| Q |
236 |
ggaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctag |
335 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16440730 |
ggaagtgaataaaccggcgcattaggcttttatatagagcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcctttagatctag |
16440631 |
T |
 |
| Q |
336 |
ggtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16440630 |
ggtttgggagcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
16440573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 238 - 421
Target Start/End: Original strand, 16161654 - 16161837
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| |||| |||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
16161654 |
aaatgaaaaaaccggcgcgctagggttttatatagagcgttagaccggaccggttcaagaccggtccaattccctgcgttgtgagcccttagatctaggg |
16161753 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttgagtgtgggctttgggtttgggcct |
421 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16161754 |
tttggggtcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatccattgagtgtgggctttgggtttgggcct |
16161837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 241 - 393
Target Start/End: Complemental strand, 16455628 - 16455475
Alignment:
| Q |
241 |
tgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccct-gcgttgtgagcctttagatctagggtt |
339 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16455628 |
tgaataaatcggcgcattaggcttttatatagagcgctagaccggaccggttcaagaccggtccaatccccttgcgttgtgagcctttagatctagggtt |
16455529 |
T |
 |
| Q |
340 |
tgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
16455528 |
tgggatcttggatcaatccaacgaaccctgagcgtctctgtgagatccgtatcc |
16455475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 264 - 388
Target Start/End: Original strand, 17242238 - 17242362
Alignment:
| Q |
264 |
tttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatccaacga |
363 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17242238 |
tttatatagagtgctaaaccggaccggttcaagaccggtccaatcccatgtgttgtgagcccttagatctagggtttgggatcttggatcaatccaacga |
17242337 |
T |
 |
| Q |
364 |
tccctgagcgtccctgtgagatccg |
388 |
Q |
| |
|
|||||||| || ||||||||||||| |
|
|
| T |
17242338 |
tccctgagagttcctgtgagatccg |
17242362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 362
Target Start/End: Complemental strand, 5802974 - 5802941
Alignment:
| Q |
329 |
gatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5802974 |
gatctagggtttgggatcttggatcaatccaacg |
5802941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 326 - 362
Target Start/End: Original strand, 23764216 - 23764252
Alignment:
| Q |
326 |
ttagatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23764216 |
ttagatctagggtttggcatcttggatcaatccaacg |
23764252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 376
Target Start/End: Original strand, 7368335 - 7368385
Alignment:
| Q |
326 |
ttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtcc |
376 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| | |||| |||||| |
|
|
| T |
7368335 |
ttagatctagggtttggcatcttggatcaatctaacggttcctgtgcgtcc |
7368385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 15853378 - 15853428
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || | ||||||||||||| |||||| |
|
|
| T |
15853378 |
tgagcctttagatctagggtttggtttcctagatcaatccaacgctccctg |
15853428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 16036024 - 16036074
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| | |||||| |
|
|
| T |
16036024 |
tgagcctttagatctagggtttggcttcctggatcaatccaatgctccctg |
16036074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 16050748 - 16050798
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| | |||||| |
|
|
| T |
16050748 |
tgagcctttagatctagggtttggcttcctggatcaatccaatgctccctg |
16050798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 141; Significance: 9e-74; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 241 - 393
Target Start/End: Complemental strand, 18836 - 18684
Alignment:
| Q |
241 |
tgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggttt |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18836 |
tgaataaaccggcgcattaggcttttatatagagcgctagaccggaccggttcaagaccggtctaatcccctgcgttgtgagcctttagatctagggttt |
18737 |
T |
 |
| Q |
341 |
gggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18736 |
gggatcttggatcaatccaacgatccctgagcgtctctgtgagatccgtatcc |
18684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 136; Significance: 8e-71; HSPs: 18)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 238 - 397
Target Start/End: Original strand, 26772842 - 26773001
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
26772842 |
aaatgaaaaaaccggcgcattaggcttttatatagggcgctagaccggaccggttcaagaccggtccaaccccctgcgttgtgagcccttagatctaggg |
26772941 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttg |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26772942 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccggatcctttg |
26773001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 238 - 397
Target Start/End: Original strand, 27283079 - 27283238
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
27283079 |
aaatgaaaaaaccggcgcattaggcttttatatagggcgctagaccggaccggttcaagaccggtccaaccccctgcgttgtgagcccttagatctaggg |
27283178 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttg |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27283179 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccggatcctttg |
27283238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 241 - 385
Target Start/End: Original strand, 22897942 - 22898086
Alignment:
| Q |
241 |
tgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggttt |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22897942 |
tgaataaaccggcgcattaggcttttatatagagcgctagaacggaccagttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggttt |
22898041 |
T |
 |
| Q |
341 |
gggatcttggatcaatccaacgatccctgagcgtccctgtgagat |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22898042 |
gggatcttggatcaatccaacgatccctgagcgtccctgtgagat |
22898086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 33510912 - 33511068
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33510912 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
33511011 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
33511012 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
33511068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 33526175 - 33526331
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33526175 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
33526274 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
33526275 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
33526331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 30144273 - 30144428
Alignment:
| Q |
237 |
gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg |
336 |
Q |
| |
|
|||||||| |||||||||| |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
30144273 |
gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg |
30144371 |
T |
 |
| Q |
337 |
gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
30144372 |
gtttgggatcttggatcaatccaacgatccctgagcattcctgtgagatccggatcc |
30144428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 30178323 - 30178478
Alignment:
| Q |
237 |
gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg |
336 |
Q |
| |
|
|||||||| |||||||||| |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
30178323 |
gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg |
30178421 |
T |
 |
| Q |
337 |
gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||| |||| |
|
|
| T |
30178422 |
gtttgggatcttggatcaatccaacgatccctgagcattcctgtgagatccggatcc |
30178478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 34494526 - 34494476
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
34494526 |
tgagcctttagatctagggtttggtttcttggatcaatccaacgctccctg |
34494476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 28899289 - 28899243
Alignment:
| Q |
264 |
tttatatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28899289 |
tttatatagaccactagaccggaccggttcaagaccggtccaatccc |
28899243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 28935684 - 28935638
Alignment:
| Q |
264 |
tttatatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28935684 |
tttatatagaccactagaccggaccggttcaagaccggtccaatccc |
28935638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 421
Target Start/End: Complemental strand, 18118909 - 18118872
Alignment:
| Q |
384 |
atccgtatcctttgagtgtgggctttgggtttgggcct |
421 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18118909 |
atccgtatcttttgagtgtgggctttgggtttgggcct |
18118872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 421
Target Start/End: Complemental strand, 18129289 - 18129252
Alignment:
| Q |
384 |
atccgtatcctttgagtgtgggctttgggtttgggcct |
421 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18129289 |
atccgtatcttttgagtgtgggctttgggtttgggcct |
18129252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 265 - 310
Target Start/End: Complemental strand, 23723686 - 23723641
Alignment:
| Q |
265 |
ttatatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
||||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
23723686 |
ttatatagacccctagaccggaccggttcaagaccggtccaatccc |
23723641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 369
Target Start/End: Complemental strand, 22269888 - 22269842
Alignment:
| Q |
323 |
cctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
22269888 |
cctttagatctagggtttggcttcctggatcaatccaacgctccctg |
22269842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 310
Target Start/End: Original strand, 30956018 - 30956060
Alignment:
| Q |
268 |
tatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
30956018 |
tatagacccctagaccggaccggttcaagaccggtccaatccc |
30956060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 358
Target Start/End: Original strand, 11544885 - 11544962
Alignment:
| Q |
281 |
accggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatcc |
358 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| ||| || ||||||||||||| || ||||||||||| |
|
|
| T |
11544885 |
accggaccggttcaagaccggtccaatccccttcgttcctggccgttggatctagggtttgatctcctggatcaatcc |
11544962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 358
Target Start/End: Original strand, 11558944 - 11559021
Alignment:
| Q |
281 |
accggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatcc |
358 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| ||| || ||||||||||||| || ||||||||||| |
|
|
| T |
11558944 |
accggaccggttcaagaccggtccaatccccttcgttcctggccgttggatctagggtttgatctcctggatcaatcc |
11559021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 310
Target Start/End: Original strand, 30929143 - 30929176
Alignment:
| Q |
277 |
ctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
30929143 |
ctagaccggaccggttcaagaccggtccaatccc |
30929176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0252 (Bit Score: 116; Significance: 7e-59; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 238 - 397
Target Start/End: Complemental strand, 1244 - 1085
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1244 |
aaatgagtaaaccggcgcactagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
1145 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcctttg |
397 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| ||||||| |
|
|
| T |
1144 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcctttg |
1085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 113; Significance: 4e-57; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 130073 - 129917
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
130073 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
129974 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
129973 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
129917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 113; Significance: 4e-57; HSPs: 16)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 7987116 - 7987272
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7987116 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
7987215 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
7987216 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
7987272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 30563682 - 30563526
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30563682 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
30563583 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
30563582 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
30563526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 27002227 - 27002382
Alignment:
| Q |
237 |
gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg |
336 |
Q |
| |
|
|||||||| |||||||||| |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
27002227 |
gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg |
27002325 |
T |
 |
| Q |
337 |
gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
27002326 |
gtttgggatcttggatcaatccaacgatccctgagcgttcctgtgagatccggatcc |
27002382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 27017733 - 27017888
Alignment:
| Q |
237 |
gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg |
336 |
Q |
| |
|
|||||||| |||||||||| |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
27017733 |
gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg |
27017831 |
T |
 |
| Q |
337 |
gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
27017832 |
gtttgggatcttggatcaatccaacgatccctgagcgttcctgtgagatccggatcc |
27017888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 27192209 - 27192365
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27192209 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
27192308 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||| ||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
27192309 |
tttaggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
27192365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 27204062 - 27204218
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27204062 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
27204161 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||| ||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
27204162 |
tttaggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
27204218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 27245169 - 27245013
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27245169 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
27245070 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||| ||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
27245069 |
tttaggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
27245013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 27257032 - 27256876
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27257032 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
27256933 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||| ||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
27256932 |
tttaggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
27256876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 246 - 394
Target Start/End: Complemental strand, 30548403 - 30548255
Alignment:
| Q |
246 |
aaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggat |
345 |
Q |
| |
|
|||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30548403 |
aaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctagggtttgggac |
30548304 |
T |
 |
| Q |
346 |
cttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
30548303 |
cttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
30548255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 317 - 362
Target Start/End: Original strand, 20133585 - 20133630
Alignment:
| Q |
317 |
tgtgagcctttagatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20133585 |
tgtgagcctttagatctagggtttttgatcttggatcaatccaacg |
20133630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 317 - 362
Target Start/End: Complemental strand, 22199284 - 22199239
Alignment:
| Q |
317 |
tgtgagcctttagatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22199284 |
tgtgagcctttagatctagggtttttgatcttggatcaatccaacg |
22199239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 310
Target Start/End: Complemental strand, 22940556 - 22940514
Alignment:
| Q |
268 |
tatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
22940556 |
tatagaccactagaccggaccggttcaagaccggtccaatccc |
22940514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 310
Target Start/End: Complemental strand, 23863000 - 23862958
Alignment:
| Q |
268 |
tatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
23863000 |
tatagaccactagaccggaccggttcaagaccggtccaatccc |
23862958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 25178762 - 25178812
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||| |||| |||||| |
|
|
| T |
25178762 |
tgagcctttagatctagggtttggcttcctggatcaatcaaacgctccctg |
25178812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 310
Target Start/End: Complemental strand, 30721806 - 30721773
Alignment:
| Q |
277 |
ctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
30721806 |
ctagaccggaccggttcaagaccggtccaatccc |
30721773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 317
Target Start/End: Original strand, 18939635 - 18939671
Alignment:
| Q |
281 |
accggactggttcaagaccggtccaatcccctgcgtt |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
18939635 |
accggaccggttcaagaccggtccaatccccttcgtt |
18939671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 113; Significance: 4e-57; HSPs: 16)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 17975159 - 17975003
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17975159 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
17975060 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
17975059 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
17975003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 17990707 - 17990551
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
17990707 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
17990608 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
17990607 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
17990551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 18219688 - 18219844
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18219688 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
18219787 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
18219788 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
18219844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 18234996 - 18235152
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18234996 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
18235095 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
18235096 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
18235152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 28333779 - 28333934
Alignment:
| Q |
237 |
gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg |
336 |
Q |
| |
|
|||||||| |||||||||| |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
28333779 |
gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg |
28333877 |
T |
 |
| Q |
337 |
gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
28333878 |
gtttgggatcttggatcaatccaacgatccctgagcgttcctgtgaaatccggatcc |
28333934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 237 - 393
Target Start/End: Original strand, 28348881 - 28349036
Alignment:
| Q |
237 |
gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg |
336 |
Q |
| |
|
|||||||| |||||||||| |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
28348881 |
gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagcccttagatctagg |
28348979 |
T |
 |
| Q |
337 |
gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||| |
|
|
| T |
28348980 |
gtttgggatcttggatcaatccaacgatccctgagcgttcctgtgaaatccggatcc |
28349036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 28166969 - 28166920
Alignment:
| Q |
265 |
ttatatagagcgctagaccggactggttcaagaccggtccaatcccctgc |
314 |
Q |
| |
|
||||||||| | ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28166969 |
ttatatagaccactagaccggaccggttcaagaccggtccaatcccctgc |
28166920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 14142608 - 14142558
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
14142608 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg |
14142558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 18525048 - 18525098
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
18525048 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg |
18525098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 319 - 368
Target Start/End: Complemental strand, 23012643 - 23012594
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccct |
368 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
23012643 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgctccct |
23012594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 321 - 369
Target Start/End: Original strand, 19448511 - 19448559
Alignment:
| Q |
321 |
agcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
19448511 |
agcctttagatctagggtttggcttcctggatcaatccaacgctccctg |
19448559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 360
Target Start/End: Complemental strand, 15365098 - 15365064
Alignment:
| Q |
326 |
ttagatctagggtttgggatcttggatcaatccaa |
360 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15365098 |
ttagatctagggtttggcatcttggatcaatccaa |
15365064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 310
Target Start/End: Original strand, 4653281 - 4653314
Alignment:
| Q |
277 |
ctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
4653281 |
ctagaccggaccggttcaagaccggtccaatccc |
4653314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 388
Target Start/End: Original strand, 17786865 - 17786905
Alignment:
| Q |
348 |
tggatcaatccaacgatccctgagcgtccctgtgagatccg |
388 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
17786865 |
tggatcaatccaacgatccctgagctttcctgtgtgatccg |
17786905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 388
Target Start/End: Original strand, 19088386 - 19088426
Alignment:
| Q |
348 |
tggatcaatccaacgatccctgagcgtccctgtgagatccg |
388 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
19088386 |
tggatcaatccaacgatccctgagctttcctgtgtgatccg |
19088426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 388
Target Start/End: Complemental strand, 19364916 - 19364876
Alignment:
| Q |
348 |
tggatcaatccaacgatccctgagcgtccctgtgagatccg |
388 |
Q |
| |
|
||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
19364916 |
tggatcaatccaacgatccctgagctttcctgtgtgatccg |
19364876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 113; Significance: 4e-57; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 16819799 - 16819643
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16819799 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
16819700 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
16819699 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
16819643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 16835040 - 16834884
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16835040 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
16834941 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
16834940 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
16834884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 16875021 - 16874865
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16875021 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
16874922 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
16874921 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
16874865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 32059536 - 32059692
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
32059536 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgtagtgagcccttagatctaggg |
32059635 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
32059636 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
32059692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 32044340 - 32044496
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
32044340 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgtagtgagcccttagatctaggg |
32044439 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||| ||||||||| |||| |
|
|
| T |
32044440 |
tttgggaccttggatcaatccaacggtccctgagtatccctgggagatccgtttcct |
32044496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 237 - 388
Target Start/End: Original strand, 35763430 - 35763580
Alignment:
| Q |
237 |
gaaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagg |
336 |
Q |
| |
|
|||||||| |||||||||| |||| ||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
35763430 |
gaaatgaaaaaaccggcgcgctagggttt-atatagagtgctagaccggaccggttcaagaccggtccaatcccatgcgttgtgagccattagatctagg |
35763528 |
T |
 |
| Q |
337 |
gtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccg |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||| ||||| |
|
|
| T |
35763529 |
gtttgggatcttggatcaatccaacgatccctgagcattcctgtgaaatccg |
35763580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 10116449 - 10116403
Alignment:
| Q |
264 |
tttatatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
10116449 |
tttatatagaccactagaccggaccggttcaagaccggtccaatccc |
10116403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 21693928 - 21693878
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
21693928 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg |
21693878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 21708709 - 21708659
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
21708709 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg |
21708659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 362
Target Start/End: Original strand, 39884674 - 39884707
Alignment:
| Q |
329 |
gatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39884674 |
gatctagggtttgggatcttggatcaatccaacg |
39884707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 362
Target Start/End: Original strand, 39900250 - 39900283
Alignment:
| Q |
329 |
gatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39900250 |
gatctagggtttgggatcttggatcaatccaacg |
39900283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 319 - 376
Target Start/End: Complemental strand, 29439389 - 29439332
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtcc |
376 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||| |||| ||||||||||| |
|
|
| T |
29439389 |
tgagcctttagatctagggtttggcttcctggatcaatctaacggctcctgagcgtcc |
29439332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 238 - 394
Target Start/End: Complemental strand, 4486748 - 4486592
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
4486748 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaattccctgcgttgtgagcccttagatctaggg |
4486649 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
4486648 |
tttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
4486592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 310
Target Start/End: Original strand, 17896831 - 17896873
Alignment:
| Q |
268 |
tatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
17896831 |
tatagacccctagaccggaccggttcaagaccggtccaatccc |
17896873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 329 - 362
Target Start/End: Original strand, 19697664 - 19697697
Alignment:
| Q |
329 |
gatctagggtttgggatcttggatcaatccaacg |
362 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
19697664 |
gatctagggtttgggatcttggatcaatctaacg |
19697697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1536 (Bit Score: 105; Significance: 3e-52; HSPs: 1)
Name: scaffold1536
Description:
Target: scaffold1536; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 238 - 394
Target Start/End: Original strand, 1040 - 1196
Alignment:
| Q |
238 |
aaatgaataaaccggcgcattaggcttttatatagagcgctagaccggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctaggg |
337 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1040 |
aaatgaaaaaaccggcgcgttagggttttatatagggcgctagaccggaccggttcaagaccggtccaatcccctgcgttgtgagcccttagatctaggg |
1139 |
T |
 |
| Q |
338 |
tttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
||| ||| ||||||||||||||||| |||||| | |||||||||||||||| |||| |
|
|
| T |
1140 |
tttaggaccttggatcaatccaacggtccctgtgtatccctgtgagatccgtttcct |
1196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 295 - 397
Target Start/End: Original strand, 47767122 - 47767224
Alignment:
| Q |
295 |
agaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcct |
394 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| |
|
|
| T |
47767122 |
agaccggtccaatcccttgcgttgtgagcccttagatctagggtttgggaccttggatcaatccaacggtccctgagtatccctgtgagatccgtttcct |
47767221 |
T |
 |
| Q |
395 |
ttg |
397 |
Q |
| |
|
||| |
|
|
| T |
47767222 |
ttg |
47767224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 16653735 - 16653689
Alignment:
| Q |
264 |
tttatatagagcgctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||||||||| |
|
|
| T |
16653735 |
tttatatagaccactagaccggaccggttcaagaccggtccaatccc |
16653689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 369
Target Start/End: Original strand, 16404800 - 16404846
Alignment:
| Q |
323 |
cctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
16404800 |
cctttagatctagggtttggcttcctggatcaatccaacgctccctg |
16404846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 20344382 - 20344332
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||| |||| |||||| |
|
|
| T |
20344382 |
tgagcctttagatctagggtttggtttcctggatcaatctaacgctccctg |
20344332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 55; Significance: 2e-22; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 319 - 393
Target Start/End: Original strand, 179180 - 179254
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtccctgtgagatccgtatcc |
393 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
179180 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgatctctgagcgtccatgtgagatccgtatcc |
179254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 319 - 369
Target Start/End: Original strand, 98267 - 98317
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
98267 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgatccctg |
98317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0750 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0750
Description:
Target: scaffold0750; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 202 - 152
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
202 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg |
152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 17295 - 17245
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
17295 |
tgagcctttagatctagggtttggcttcctggatcaatccaacgctccctg |
17245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0184 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0184
Description:
Target: scaffold0184; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 319 - 367
Target Start/End: Original strand, 21881 - 21929
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccc |
367 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
21881 |
tgagcctttagatctagggtttggtttcctggatcaatccaacgctccc |
21929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 319 - 367
Target Start/End: Complemental strand, 50963 - 50915
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccc |
367 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| |||| |
|
|
| T |
50963 |
tgagcctttagatctagggtttggtttcctggatcaatccaacgctccc |
50915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1665 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1665
Description:
Target: scaffold1665; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 329 - 372
Target Start/End: Complemental strand, 881 - 838
Alignment:
| Q |
329 |
gatctagggtttgggatcttggatcaatccaacgatccctgagc |
372 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| | ||||||| |
|
|
| T |
881 |
gatctagggtttggggtcttggatcaatccaacggttcctgagc |
838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0740 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0740
Description:
Target: scaffold0740; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 323 - 369
Target Start/End: Original strand, 945 - 991
Alignment:
| Q |
323 |
cctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
945 |
cctttagatctagggtttggcttcctggatcaatccaacgctccctg |
991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0260 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0260
Description:
Target: scaffold0260; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 319 - 369
Target Start/End: Complemental strand, 6705 - 6655
Alignment:
| Q |
319 |
tgagcctttagatctagggtttgggatcttggatcaatccaacgatccctg |
369 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||| |||| |||||| |
|
|
| T |
6705 |
tgagcctttagatctagggtttggtttcctggatcaatctaacgctccctg |
6655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0235 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0235
Description:
Target: scaffold0235; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 326 - 376
Target Start/End: Complemental strand, 259 - 209
Alignment:
| Q |
326 |
ttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtcc |
376 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| | |||| |||||| |
|
|
| T |
259 |
ttagatctagggtttggcatcttggatctatccaacggttcctgtgcgtcc |
209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0225 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0225
Description:
Target: scaffold0225; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 277 - 310
Target Start/End: Complemental strand, 306 - 273
Alignment:
| Q |
277 |
ctagaccggactggttcaagaccggtccaatccc |
310 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
306 |
ctagaccggaccggttcaagaccggtccaatccc |
273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 393
Target Start/End: Original strand, 6100 - 6212
Alignment:
| Q |
281 |
accggactggttcaagaccggtccaatcccctgcgttgtgagcctttagatctagggtttgggatcttggatcaatccaacgatccctgagcgtccctgt |
380 |
Q |
| |
|
||||||| ||||||| | |||||||| |||| | | || ||||||||||||||| ||| | || |||||| |||||||||||||||||| | || || |
|
|
| T |
6100 |
accggaccggttcaattctggtccaattccctttgatctgcgcctttagatctaggtttttgcttcctggatcgatccaacgatccctgagctttcccgt |
6199 |
T |
 |
| Q |
381 |
gagatccgtatcc |
393 |
Q |
| |
|
| |||||| |||| |
|
|
| T |
6200 |
gtgatccggatcc |
6212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University