View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_12 (Length: 357)
Name: NF10707_high_12
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 11203024 - 11203367
Alignment:
| Q |
1 |
gtctcatggcttgaaggatcctcaaggttctgctacaaagcaaagtagacagattttgactttggctgcaagttcagatggtcgctatttggcaactggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11203024 |
gtctcatggcttgaaggatcctcaaggttctgctgcaaagcaaagtagacagattttgactttggctgcaagttcggatggtcgctatttggcaactggg |
11203123 |
T |
 |
| Q |
101 |
ggacttgatcgtcatattcatatatgggatacacgcactagggagcatcttcaggtacttttgccttttcattctttgaaaataaaattgttggatattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11203124 |
ggacttgatcgtcatattcatatatgggatacacgcactagggagcatcttcaggtacttttgccttttcattctttgaaaataaaattgttggatattt |
11203223 |
T |
 |
| Q |
201 |
tttgggggtggaacagattagtacagctctaggtgcactgtgagattgtttattgtttgtatttacatattaaggaaaatttatactcctttcccttgtt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11203224 |
tttgggggtggaacagattagtacagctctaggtgcactgtgagattgtttattgtttgtatttacagattaaggaaaatttatactcctttcccttgtt |
11203323 |
T |
 |
| Q |
301 |
tggtaacattcatttttcgataaaattgtcacataactgttgat |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11203324 |
tggtaacattcatttttcgataaaattgtcacataactgttgat |
11203367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University