View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_19 (Length: 320)
Name: NF10707_high_19
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 309
Target Start/End: Original strand, 47527500 - 47527790
Alignment:
| Q |
19 |
tattctgctcataagaagttgaaccctgacttaagtatctccatcggtgccgtgaagttcgcggccaatattttatacaacatgctgaagaagcttaccg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47527500 |
tattctgctcataagaagttgaaccctgacttaagtatctccatcggtgccgtgaagttcgcggccaatattttaaacaacatgctgaagaagcttaccg |
47527599 |
T |
 |
| Q |
119 |
aggaagctgtaaagattgaatcaaatactttggatgtaaaggagatgcatgccgtggttaatcaagtctttcccgaaaaaatggccaaactagcccacca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47527600 |
aggaagctgtaaagattgaatcaaatactttggatgtaaaggagatgcatgccgtggttaatcaagtctttcccgaaaaaatggccaaactagcccacca |
47527699 |
T |
 |
| Q |
219 |
acatggtttaaatgctgtgcctaaaggtagttgattgataacctcaatgacatgatttattttagataaggtagttaattttatgtttcat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47527700 |
acatggtttaaatgctgtgcctaaaggtagttgattgataacctcaatgacatgatttattttagataaggtagttaattttatgtttcat |
47527790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University