View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_24 (Length: 299)
Name: NF10707_high_24
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 42581120 - 42580840
Alignment:
| Q |
19 |
attctttcgaattcggttatgattgatggtagttgagtgatgtggcggttgtgagaatcagaaaaattgaaaacgtgcagagagaaa-------tgagaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42581120 |
attctttcgaattcggttatgattgatggtagttgagtgatgtggcggttgtgagaatcagaaaaattgaaaacgtgcagagagaaaagagaaatgagaa |
42581021 |
T |
|
| Q |
112 |
atctaccatgattgaagcttcttcgagagaatcacggttcgagaaatggtgtatggcagtgtgatgaagtgagttggagaaggaagaagaagcagataat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42581020 |
atctaccatgattgaagcttcttcgagagaatcacggttcgagaaatggtgtatggcagtgtgatgaagtgagttggagaaggaagaagaagcagataat |
42580921 |
T |
|
| Q |
212 |
tcacagtcagaaccagaagtagggttttgggttttacagaaaacacaacagagaacagatatctttctctctcctttgctt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42580920 |
tcacagtcagaaccagaagtagggttttgggttttacagaaaacacaacagagaacagatatctttctctctcctttgctt |
42580840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University