View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_28 (Length: 263)
Name: NF10707_high_28
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 20174302 - 20174525
Alignment:
| Q |
18 |
gtttttatatctgcagcttttaaaagagtatcccagttggaaggcataattccagcagctttggaaacatcacatgctcttgcttatttagtgaaactct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20174302 |
gtttttatatctgcagcttttaaaagagtatcccagttggaaggcataattccagc---tttggaaacatcacatgctcttgcttatttagagaaactct |
20174398 |
T |
 |
| Q |
118 |
gccctacccttccaaatgaaacaaaggttgtggttaactgcagtggcagaggggataaggatgttcaaactgctatgaaatacttgaaaatttgaacgta |
217 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
20174399 |
gccctacccttccaaatggaactaaggttgtggttaactgcagtggcagaggggataaggatgttcaaactgctatgaaatacttgaaaatttgaaagta |
20174498 |
T |
 |
| Q |
218 |
catgattcagtctccaacatagttgaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
20174499 |
catgattcagtctccaacatagttgaa |
20174525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 189
Target Start/End: Complemental strand, 18402703 - 18402637
Alignment:
| Q |
123 |
acccttccaaatgaaacaaaggttgtggttaactgcagtggcagaggggataaggatgttcaaactg |
189 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
18402703 |
acccttcctaatgggacaaaggtcgtggttaacttcagtggccgaggtgataaggatgttcaaactg |
18402637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University