View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_30 (Length: 258)
Name: NF10707_high_30
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 10130960 - 10130792
Alignment:
| Q |
18 |
attatatgtagaagaacttgaacttttttagtttataggacattttgtatgtaaatattagtttcttcagagtttggctataaacttatggtaacatatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10130960 |
attatatgtagaagaacttgaacttttttagtttataggacattttgtatgtaaatattagtttcttcagagtttggctataaacttatggtaacatatc |
10130861 |
T |
 |
| Q |
118 |
agacatggattttcaaaattgtgtggttttatggaaggattttaatatgatgttagagttcattgatttg |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10130860 |
agacatggattttcaaaattgtgtggtttta-ggaaggattttaatatgatgttagatttcattgatttg |
10130792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University