View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_31 (Length: 257)
Name: NF10707_high_31
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 21 - 251
Target Start/End: Original strand, 33209416 - 33209646
Alignment:
| Q |
21 |
aaaaggtctacaattggatgtgataggttaaaagaagatcaagtagtcaaaatattgatcattaagtttcttaagtaatttaccctttccttttgttctc |
120 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33209416 |
aaaaggtttacaattggatgtgataggttaaaagaagatcaagtagtcaaaatattgatcattaagtttcttaagtaatttaccctttccttttgttctc |
33209515 |
T |
|
| Q |
121 |
ttcttttttgatagagaatgcctttgtcttctcttctctcaaataggatgtaatttactagggctacttttgttatatttgggttaattaatttgcctta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33209516 |
ttcttttttgatagagaatgcctttgtcttctcttctctcaaataggatgtaatttactagggctacttttgttatatttgggttaattaatttgcctta |
33209615 |
T |
|
| Q |
221 |
gtagaattgaaattaattgggttcttctctc |
251 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| |
|
|
| T |
33209616 |
gtagaattgaaattaattgggtccttgtctc |
33209646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University