View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10707_high_38 (Length: 249)

Name: NF10707_high_38
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10707_high_38
NF10707_high_38
[»] chr1 (1 HSPs)
chr1 (201-237)||(41866283-41866319)


Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 237
Target Start/End: Complemental strand, 41866319 - 41866283
Alignment:
201 gattgttgatttatctctattctttattgaagcctct 237  Q
    |||||||||||||||||||||||||||||||||||||    
41866319 gattgttgatttatctctattctttattgaagcctct 41866283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University