View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_53 (Length: 222)
Name: NF10707_high_53
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 46452242 - 46452450
Alignment:
| Q |
1 |
tctataaggggggcatgattaaggtctataaaatttgcggttagaagccaacaccaatctataaatataaatagtagtttctctttgaggtttttcttag |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46452242 |
tctataaggggggcatgattaaagtctataaaatttgcggttagaagccaacaccaatctataaatataaatagtagtttctctttgaggtttttcttag |
46452341 |
T |
|
| Q |
101 |
ttttaatttttaagatagggagagtaattattcactcctatggcatgatttgatgaatttgtacaaatgcataatacttgacaataaaatactctattag |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46452342 |
ttttaatttttaagagagggagagtaattattcactcctatggcatgatttgatgaatttgtacaaatgcataatacttgacaataaaatactctattag |
46452441 |
T |
|
| Q |
201 |
agagggtat |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
46452442 |
agagggtat |
46452450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University