View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_57 (Length: 211)
Name: NF10707_high_57
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 195
Target Start/End: Complemental strand, 6851319 - 6851139
Alignment:
| Q |
15 |
agagaatattgggccatagtgatgatagaggctcataaatgctagtggttaaaagtgagcagaaagataattcatgtaatcgatttcttaagattttgga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6851319 |
agagaatattgggccatagtgatgatagaggctcataaatgctagtggttaaaagtgagcagaaagataattcatgtaatcgatttcttaagattttgga |
6851220 |
T |
|
| Q |
115 |
attagtatgtggtgttcaaacttcattgtggttgattttagtgaaaggtagagatctacatgatatgttagactcttcttg |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6851219 |
attagtatgtggtgttcaaacttcattgtggttgattttagtgaaaggtagagatctacatgatatgttagactcttcttg |
6851139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University