View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_59 (Length: 207)
Name: NF10707_high_59
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_59 |
 |  |
|
| [»] scaffold0340 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 6e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 14 - 193
Target Start/End: Complemental strand, 4939061 - 4938887
Alignment:
| Q |
14 |
cagagattagtcaatattgttatgtcacttatgtgtgatgatcctaagttgttttagcaaactacgttagattattaattttaccataaagtaatcatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4939061 |
cagagattagtcaatattgttatgtcacttatgtgtgatgatcctaagttgttttagcaacctacgttagattattaattttactataaagtaatcatca |
4938962 |
T |
 |
| Q |
114 |
cagtacattaggtgtaaaggaaaggatatactaaacatatactcaaatttgaataagaatagattattatgattatatat |
193 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4938961 |
cagtacgttaggtgtaa-----aggatatactaaacatatactcaaatttggataagaatagattattatgattatatat |
4938887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 14 - 50
Target Start/End: Complemental strand, 23763495 - 23763459
Alignment:
| Q |
14 |
cagagattagtcaatattgttatgtcacttatgtgtg |
50 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23763495 |
cagagattagtcaatattgttttgtcacttatgtgtg |
23763459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0340 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0340
Description:
Target: scaffold0340; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 14 - 78
Target Start/End: Original strand, 15586 - 15650
Alignment:
| Q |
14 |
cagagattagtcaatattgttatgtcacttatgtgtgatgatcctaagttgttttagcaaactac |
78 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||| | || ||||||||||||||||| |||| |
|
|
| T |
15586 |
cagagattagccaatattgttttgtcacttatgtgtgctcatactaagttgttttagcaacctac |
15650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University