View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_61 (Length: 205)
Name: NF10707_high_61
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_61 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 20 - 186
Target Start/End: Original strand, 11202840 - 11203006
Alignment:
| Q |
20 |
ttaaattggatggtgatggtggatttgaaaatttagtgaagcataaacaatgtgtcactgcggtggctttatctgaggacgattctaaggggttttcggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202840 |
ttaaattggatggtgatggtggatttgaaaatttagtgaagcataaacaatgtgtcactgcggtggctttatctgaggacgattctaaggggttttcggc |
11202939 |
T |
|
| Q |
120 |
ttcgaaagatggaagcattgtgcaatgggatgttgagagcgggaaatgtgagaggtataagtggccc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11202940 |
ttcgaaagatggaagcattgtgcaatgggatgttgagagcgggaaatgtgagaggtataagtggccc |
11203006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University