View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10707_high_62 (Length: 205)

Name: NF10707_high_62
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10707_high_62
NF10707_high_62
[»] chr4 (3 HSPs)
chr4 (131-200)||(36960273-36960342)
chr4 (131-200)||(36950139-36950208)
chr4 (1-52)||(36960421-36960475)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 5e-27; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 131 - 200
Target Start/End: Complemental strand, 36960342 - 36960273
Alignment:
131 ctattatttatgcagaagtgcagccgatggagatacgacttcaaaggctgtgcttgattgtgaggaccct 200  Q
    |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
36960342 ctattatttatgtagaagtgcagcggatggagatacgacttcaaaggctgtgcttgattgtgaggaccct 36960273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 131 - 200
Target Start/End: Complemental strand, 36950208 - 36950139
Alignment:
131 ctattatttatgcagaagtgcagccgatggagatacgacttcaaaggctgtgcttgattgtgaggaccct 200  Q
    |||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
36950208 ctattatttatgtagcagtgcagccgatggagatatgacttcaaaggctgtgcttgattgtgaggaccct 36950139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 36960421 - 36960475
Alignment:
1 cacttgcatctttcattacagatgctttagcaataa---attgaaagatgcaagt 52  Q
    ||||||||||||||||||||||||||||||||||||   ||||||||||||||||    
36960421 cacttgcatctttcattacagatgctttagcaataatctattgaaagatgcaagt 36960475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University