View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_high_62 (Length: 205)
Name: NF10707_high_62
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_high_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 5e-27; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 131 - 200
Target Start/End: Complemental strand, 36960342 - 36960273
Alignment:
| Q |
131 |
ctattatttatgcagaagtgcagccgatggagatacgacttcaaaggctgtgcttgattgtgaggaccct |
200 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36960342 |
ctattatttatgtagaagtgcagcggatggagatacgacttcaaaggctgtgcttgattgtgaggaccct |
36960273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 131 - 200
Target Start/End: Complemental strand, 36950208 - 36950139
Alignment:
| Q |
131 |
ctattatttatgcagaagtgcagccgatggagatacgacttcaaaggctgtgcttgattgtgaggaccct |
200 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36950208 |
ctattatttatgtagcagtgcagccgatggagatatgacttcaaaggctgtgcttgattgtgaggaccct |
36950139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 36960421 - 36960475
Alignment:
| Q |
1 |
cacttgcatctttcattacagatgctttagcaataa---attgaaagatgcaagt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36960421 |
cacttgcatctttcattacagatgctttagcaataatctattgaaagatgcaagt |
36960475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University