View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_16 (Length: 378)
Name: NF10707_low_16
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 196 - 348
Target Start/End: Complemental strand, 3450975 - 3450825
Alignment:
| Q |
196 |
ccatcaactccgaccgccttgtactaaaataaaaccaccatcctcatcccctctttctcttctataaactatannnnnnngactctcatttctggccccc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3450975 |
ccatcaactccgaccgccttgtactaaaataaaaccaccatcctcatcccctctttctcttctataaactata-tttttcgactctcatttctggccccc |
3450877 |
T |
 |
| Q |
296 |
acaagcttccattgacgaaactaagctatgcagtagaacctcccttcatcttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3450876 |
acaagcttccattgacgaaactaagctatgcagtagaacct-ccttcatcttt |
3450825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 17 - 156
Target Start/End: Complemental strand, 3451138 - 3451001
Alignment:
| Q |
17 |
aaccagcacttagata--acatcatagtagttatgttaggtcatatacttacataaagtaaattttagactatttatttatacccttaataaccagacgg |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451138 |
aaccagcacttagatataacatcatagtagttatgttaggtcatatacttacataaagtaaattttagactatttatttatacccttaataaccagacgg |
3451039 |
T |
 |
| Q |
115 |
gtctctatatatgcatgcatgcatgctttccctttttccttc |
156 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3451038 |
gtctctatatatgcatgc----atgctttccctttttccttc |
3451001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University