View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_25 (Length: 343)
Name: NF10707_low_25
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 180 - 298
Target Start/End: Original strand, 32453490 - 32453608
Alignment:
| Q |
180 |
tacaacttcttccgtttagaagatccaagaaatagagaagagatgtcaatttcatgtggatcccatgcttttctttttctttgcaaaactgaagagaaag |
279 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
32453490 |
tacaacttctcccgtttagaagatccaagaaatagagaagagatgtcaatttcatgtggatcccatgcttttctttttcttcgcagaactgaagagaaag |
32453589 |
T |
|
| Q |
280 |
atgagagaaagctttactc |
298 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32453590 |
atgagagaaagctttactc |
32453608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 21 - 144
Target Start/End: Original strand, 32453330 - 32453453
Alignment:
| Q |
21 |
tagtgattgttgcggggatcacataaattttaaaattgaaccatttgtctttagagttaattgtttaatatgaaatagataatcttgactcttacactct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| | |
|
|
| T |
32453330 |
tagtgattgttgcggggatcacataaattttaaaattgaaccatttgtctttagagttaattgtttaatctgaaatagataaacttgactcttacactgt |
32453429 |
T |
|
| Q |
121 |
gtttgatacacaagaaataagggc |
144 |
Q |
| |
|
||||| ||| |||||||||||||| |
|
|
| T |
32453430 |
gtttggtacgcaagaaataagggc |
32453453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 180 - 278
Target Start/End: Complemental strand, 50564112 - 50564014
Alignment:
| Q |
180 |
tacaacttcttccgtttagaagatccaagaaatagagaagagatgtcaatttcatgtggatcccatgcttttctttttctttgcaaaactgaagagaaa |
278 |
Q |
| |
|
|||||||||| ||||||| |||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
50564112 |
tacaacttctcccgtttaaaagatcgaagaaatagagaagagataccaatttcacgtggatcccatgcttttctttttcttcgcagaactgaagagaaa |
50564014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University