View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_38 (Length: 283)
Name: NF10707_low_38
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 38069529 - 38069247
Alignment:
| Q |
1 |
cagatgtccagtcttgggcgtgagagggatgtgtttagtgtcccacattgaatgtgaaatggtctttgataggctttgataccattttagaatttgggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38069529 |
cagatgtccagtcttgggcgtgagagggatgtgtttagtgtcccacattgaatgtgaaatggtctttgataggctttgataccattttagaatttgggtt |
38069430 |
T |
 |
| Q |
101 |
gaacttgccacatttcttacggaaccggcttgtaaggtgaggattataaacacatttttagaccatatctcatgcaatgtgagactcctaacaaaactaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38069429 |
gaacttgccacatttcttacggaaccggcttgtaaggtgaggattataaacacatttttagaccatatctcatgcaatgcgagactcctaacaaaactaa |
38069330 |
T |
 |
| Q |
201 |
tactttgacttcaaatttttgttctacacttgtacctttgcttgctcttacttcaattgtggtatctttcctcatataatcgt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38069329 |
tactttgacttcaaatttttgttctacacttgtacctttgcttgctcttacttcaattgtggtatctttcctcatataatcgt |
38069247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 186
Target Start/End: Complemental strand, 10485448 - 10485406
Alignment:
| Q |
144 |
ttataaacacatttttagaccatatctcatgcaatgtgagact |
186 |
Q |
| |
|
||||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
10485448 |
ttataaacacattttcagactatatctcatccaatgtgagact |
10485406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 145 - 186
Target Start/End: Complemental strand, 19385767 - 19385726
Alignment:
| Q |
145 |
tataaacacatttttagaccatatctcatgcaatgtgagact |
186 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
19385767 |
tataaactcatttttaggccatatctcatccaatgtgagact |
19385726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 63 - 99
Target Start/End: Complemental strand, 19385647 - 19385611
Alignment:
| Q |
63 |
tctttgataggctttgataccattttagaatttgggt |
99 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
19385647 |
tcttggataggctttgataccatcttagaatttgggt |
19385611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 173
Target Start/End: Complemental strand, 37824223 - 37824194
Alignment:
| Q |
144 |
ttataaacacatttttagaccatatctcat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37824223 |
ttataaacacatttttagaccatatctcat |
37824194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University