View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_40 (Length: 277)
Name: NF10707_low_40
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 108 - 267
Target Start/End: Complemental strand, 44841849 - 44841668
Alignment:
| Q |
108 |
ggaaatagtttcatcatcaaagtagtaattgtcatgattccttggaaatgtttgttgacattaacttgagagatgaatatg------------------- |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44841849 |
ggaaatagtttcatcatcaaagtagtaattgtcatgattccttggaaatgtttgttgacattaacttgagagatgaatatgatttcctgcgtgtgtacct |
44841750 |
T |
|
| Q |
189 |
---aatgtcattatgttgtactttgctcttcttttcctatttgcgatgattgtcaatgtttcttacctcatgtatatctgtg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44841749 |
gtcaatgtcattatgttgtactttgctcttcttttcctatttgcgatgattgtcaatgtttcttacctcatgtatatctgtg |
44841668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University