View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_43 (Length: 267)
Name: NF10707_low_43
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 19 - 255
Target Start/End: Complemental strand, 7141169 - 7140933
Alignment:
| Q |
19 |
ctgatgtcagcgcctataacaaaaagataattccctttgaaaacattagacaaatcacatcagccatagtgagtaacacgtccagattgactcccattga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
7141169 |
ctgatgtcagcgcctataacaaaaagataattccctttgaaaaccctagacaaatcacaccagccataatgagaaacacgtccagattgactcccattga |
7141070 |
T |
|
| Q |
119 |
aactctgtcggctgcagttctcccggtgcctccatgctgcttaattccccttgacttgtgtcaaccttgatcagtgtatcaaatcacttccctccatcgt |
218 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||| |||| |||| ||||||||||| |||||| |||||| ||||| ||| ||| ||| |||||| |
|
|
| T |
7141069 |
aattctgtcggttgcagttctcccggtgcctccatgccgcttgattctccttgacttgtcccaacctcgatcagcctatcagatcgctttccttcatcgt |
7140970 |
T |
|
| Q |
219 |
gagctcacctcctgatccccccatttagtgccacctt |
255 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
7140969 |
gagctcacctcttgatccccccatttagtgtcacctt |
7140933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University