View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_51 (Length: 253)
Name: NF10707_low_51
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 33063760 - 33064001
Alignment:
| Q |
1 |
gtttactttcataaatgttaaattttttaagccctttgtgttcatattatgataatgtgttttgattgatggtgagttttgggatcaaacaaggaaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33063760 |
gtttactttcataaatgttaaattttttaagccctttgtgttcatattatgataatgtgttttgattgatggtgagttttgggatcaaacaaggaaaagt |
33063859 |
T |
 |
| Q |
101 |
gtgaagaatttttcaaaagtgagttctgaagttgtccttgttttaatcaaggaagctttatgcaccgggtgattccctcagaattagattcttattggtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33063860 |
gtgaagaatttttcaaaagtgagttctgaagttgtccttgttttaatcaaggaagctttatgcaccgggtgattccctcagaattagattcttattggtg |
33063959 |
T |
 |
| Q |
201 |
ttggtgcttgattgattccttgtaacaacttttttctgtgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33063960 |
ttggtgcttgattgattccttgtaacaacttttttctgtgct |
33064001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University