View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_55 (Length: 249)
Name: NF10707_low_55
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 49767139 - 49766894
Alignment:
| Q |
1 |
tttcaccgatttattttatttcttttaccaattttagcctctattcaatctaaaatgccgacatcttcaccacccaccagccaccaccaaatgcatatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767139 |
tttcaccgatttattttatttcttttaccaattttagcctctattcaatctaaaatgccgacatcttcaccacccaccagccaccaccaaatgcatatat |
49767040 |
T |
 |
| Q |
101 |
attgatattagctatatatctctagaaaaagtggaaac--tatgccctacaacaagagagttttcatagtatatgacagaatccaagatcgtaaacaaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49767039 |
attgatattagctatatatctctagaaaaagtggaaactatatgccctacaacaagagagttttcatagtatatgacagaatccaagatcgtaaacaaaa |
49766940 |
T |
 |
| Q |
199 |
ctatacatgactttcaaatctaatctaacacatcgtctctgcttct |
244 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
49766939 |
ctatacatgactttcaaatataatctaacacatcgtccctgcttct |
49766894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University