View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_57 (Length: 249)
Name: NF10707_low_57
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 237
Target Start/End: Complemental strand, 41866319 - 41866283
Alignment:
| Q |
201 |
gattgttgatttatctctattctttattgaagcctct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41866319 |
gattgttgatttatctctattctttattgaagcctct |
41866283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University