View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_58 (Length: 247)
Name: NF10707_low_58
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_58 |
 | |
|
| [»] scaffold0330 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0330 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 6305 - 6191
Alignment:
| Q |
8 |
ctttaaaaatttgagttgttttgttgtcggcaaaggtgttaaaaacatatttggaatggattttaatgtggaattagtcttgtaattccaatatttgagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6305 |
ctttaaaaatttgagttgttttgttgtcggcaaaggtgttgaaaacatatttggaatggattttaatgtggaattagtcttgtaattccaatatttgagg |
6206 |
T |
|
| Q |
108 |
gtatataagatatta |
122 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
6205 |
gtatatatgatatta |
6191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University