View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_67 (Length: 238)
Name: NF10707_low_67
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_67 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 35867306 - 35867525
Alignment:
| Q |
1 |
gattacccatgagtattccagaaagtctcagagccatgggaatcgctggattcagaatctcttcactgtgaagaaacgatttcagttgaagaagaagaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35867306 |
gattacccatgagtattccagaaagtctcagagccatgggaatcgctggattcagaatctcttcactgtgaagaaacgatttcagttaaagaagaagaag |
35867405 |
T |
|
| Q |
101 |
gataagcatgtaaataatcgattatgagtaaaagtgattttaattaccagattttgatgatattgagtttattcaactttttcctgttgatcttggcgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
35867406 |
aataagcatgtaaataatcgattatgagtaaaagtgattttaattaccagattttgatgatattgagcttattcaacttcttcctgttgatcttggcgtg |
35867505 |
T |
|
| Q |
201 |
catcgttgccgccatccttc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35867506 |
catcgttgccgccatccttc |
35867525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 2 - 75
Target Start/End: Original strand, 34817246 - 34817319
Alignment:
| Q |
2 |
attacccatgagtattccagaaagtctcagagccatgggaatcgctggattcagaatctcttcactgtgaagaa |
75 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34817246 |
attacccatgagtattccagaaagtctaagagccatgggaatcgctggattcagaatttcttcactgtgaagaa |
34817319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 34817388 - 34817464
Alignment:
| Q |
144 |
ttaccagattttgatgatattgagtttattcaactttttcctgttgatcttggcgtgcatcgttgccgccatccttc |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34817388 |
ttaccagattttgatgatattgagcttattcaacttcttcctgttgatcttagcgtgcatcgttgccgccatccttc |
34817464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University