View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_68 (Length: 237)
Name: NF10707_low_68
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 9190725 - 9190938
Alignment:
| Q |
1 |
cgtcaacaaaaattgaagcannnnnnnctttggaattctgcaataaccaacacaaagatgttaattaatcacataaaaagatacaaggttaacaacttta |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9190725 |
cgtcaacaaaaattgaagcatttttttctttggaattctgcaaaaaccaacacaaagatgttaattaatcacataaaaagagacaaggttaacaacttta |
9190824 |
T |
 |
| Q |
101 |
atatcaaatagatagataaagggtatttggattttgtgccnnnnnnncttggatgggtaaggttcaaagaaaatatttaactcaatgtttaagaagaaga |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9190825 |
atatcaa----atagataaagggtatttggattttgtgcctttttttcttggatgggtaaggttcaaagaaaatatttaactcaatgtttaagaagaaga |
9190920 |
T |
 |
| Q |
201 |
aggtagatggtgtttgac |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9190921 |
aggtagatggtgtttgac |
9190938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University