View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_79 (Length: 213)
Name: NF10707_low_79
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_79 |
 | |
|
| [»] scaffold0045 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 4 - 207
Target Start/End: Original strand, 42550183 - 42550390
Alignment:
| Q |
4 |
ttctaccttcatttcaatcttatcatggttacg----gtttttattctaaacgcttcaattttaacacctttggttagaacatcaacaatctgattcaca |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42550183 |
ttctaccttcatttcaatcttatcatggttacgttttttttttattctaaacgcttcaattttaacacctttggttagaacatcaacaatctgattcaca |
42550282 |
T |
|
| Q |
100 |
cttttgtaatcttccaacacatcttgatacccaaatatgacattcatttgcttgcaccaattatcataattcttcccatcatgaatgagaagatttgcag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42550283 |
cttttgtaatcttccaacacatcttgatacccaaatatgacattcatttgcttgcaccaattaccataattcttcccatcatgaatgagaagatttgcag |
42550382 |
T |
|
| Q |
200 |
gaaagttt |
207 |
Q |
| |
|
|||||||| |
|
|
| T |
42550383 |
gaaagttt |
42550390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 117
Target Start/End: Original strand, 15038919 - 15038989
Alignment:
| Q |
47 |
taaacgcttcaattttaacacctttggttagaacatcaacaatctgattcacacttttgtaatcttccaac |
117 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||| ||||||||||| |||||||| ||| ||||||| |
|
|
| T |
15038919 |
taaacacttcaatcttaacacctttggttagaacatctgcaatctgattctcacttttggaatgttccaac |
15038989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 174
Target Start/End: Original strand, 22583050 - 22583108
Alignment:
| Q |
116 |
acacatcttgatacccaaatatgacattcatttgcttgcaccaattatcataattcttc |
174 |
Q |
| |
|
|||| |||||||| ||||||| || ||||| |||||||||||| |||||||||||||| |
|
|
| T |
22583050 |
acacttcttgatatccaaatacaactttcatatgcttgcaccaactatcataattcttc |
22583108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 162 - 207
Target Start/End: Complemental strand, 29941 - 29896
Alignment:
| Q |
162 |
atcataattcttcccatcatgaatgagaagatttgcaggaaagttt |
207 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||||||| |||||| |
|
|
| T |
29941 |
atcataattcttcccatcaagaattataagatttgcagggaagttt |
29896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University