View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10707_low_81 (Length: 208)
Name: NF10707_low_81
Description: NF10707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10707_low_81 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 157
Target Start/End: Complemental strand, 12104151 - 12104012
Alignment:
| Q |
18 |
aaatcaattttatagaatcaatccggttaaaaccaatccactcaaacataaatggctttgcatttctgcgttttttgtgcggtctgatcatgggattgta |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12104151 |
aaatcaattttatagaatcaatcctgttaaaaccaatccactcaaacataaatggctttgcatttctgcgttttttgtgcggtctgatcatgggattgta |
12104052 |
T |
 |
| Q |
118 |
gaggctttgagctgcaactctgcaattttttcagctcagt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12104051 |
gaggctttgagctgcaactctgcaattttttcagctcagt |
12104012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University